Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13507  (registered. 2007)
Contig Information
Length 986 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 5
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022634 [Oryza sativa (japonica cultivar-group)]
Score 941
Evalue 1.08074e-99
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13507
ttttttttttcaaaaaacaaagggatacaagtcacccatATTTtccaagAAACCA*GCCTAACGTCAATACAATAAATTGCTGCTCATCAGTTCAAAAAA
AATTTAATTGCTGCTCATCATATCAAAGAAATAATATTTTGGCCTCATTTATATAACTAAGTGGACATGATAACTAGTCAAAAACGTATGATATTTGAAA
TCATTGTGCAAAGTATCAACAAGTAGAAAGAGCATCCATAAGGAAGCATTTAACTGGGACATCATTACAAAAACACTGAGCTTGCGAAAGGCACATAACA
GATCCACAGCTACTAGCCAGCTCCGCAGTCAAAATTCCAAGCCTCAAGCCTTGCTGGCAATGTTACTAGATAGCCAGTCCAGGCCCTCATACAGACCCTC
ACCGGATGTAGCACATGTGCTCTGGATGTACCAGTGACGTTGACGAAGGGAATGTAATCCAAGCTTATCAGTAATTTCAGCAGCATTCATAGCATTTGGA
AGATCTTGCTTGTTGGCAAAGACAAGCAACACAGAATCGCGCAACTCATCCTCATTCAGCATCCTGTGGAGCTCATCTCTGGCTTCAACAACACGGTCCC
TATCATTGCTGTCCACAACAAAGATAAGACCCT*GCGTGTTCTGG*AAGTAATGCCTCCAGAGAGGTCTGATCTTGTCCTGACCCCCAACATCCCAAACA
GTGAAGCTAATGTTCTTGTACTCGACAGTTTCAACATTGAACCCTATGGTTGGGATAGTGGTAACGATCTCGCCGAGCTTCAGCTTGTAGAGGATGGTGG
TCTTTCCGGCGGCATCAAGACCGACCATGAGGATCCGCATCTCCTTCTTGGCGAAGAGCCGGCTGAAGAGCTTCCCGAACGCGAGCCCCATCTCGCCCTA
CCCCTCTTCCGAACACCTGCGAAGAAATTTGGGGGAATTGTTAGTCGGAGAAGGACGCGGATGGTGGGGAGATAATAGTCGTGCct
page-top