Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13467  (registered. 2007)
Contig Information
Length 611 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADP-thioredoxin reductase C precursor [Hordeum vulgare]
Score 667
Evalue 2.5816e-68
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13467
aattcggcacgagGTTGAAAGATACTTAGTCTCCAATGATCTTCTTGTTGAATTTCACCAGCCTGTTCGTGAAGAGAAAAAGAAGGAGATTGAAGGCAAA
GATGTCGAGATGGGCTTCGACATTACTCACACAAAGCACAAAGGACAGTATGCACTCCGCAAGTTATACCATGGAAGTCCAAGGCTCATTTTGGTTCTAT
ATACTTCTCCAACATGTGGTCCCTGCAGAACATTAAAACCAATTTTGAACAAGGTTATAGATGAATATGACGAATACGTTCATTTTGTTGAAATTGACAT
CGAGGAGGACCCTGAAATAGCAGAAGCTGCAGGCATAATGGGGACACCATGTGTTCAGTTCTTTAAAAACAAAGAAATGATCAGGACTTTCTCTGGTGTG
AAGATGAAGAAGGAATACCGGGAGTTCATCGAGTCGAACAAATGATCTGAGCTCAATGTTCGTTCCAGGGTTTTGAGGTGTAATGGCCTCCATTTACACA
TATATTGACTATATTTAGAAGCCACGCTGGTGGGCAATTTTTGGTCAAAATTCTCAGATGAGCCTGGTGCAGTCCGATGCCATAGGAAATTAACCGACCG
CCCTTattgaa
page-top