Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13447  (registered. 2007)
Contig Information
Length 946 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 4
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ACT7 (actin 7) [Arabidopsis thaliana] >gi|1703108|sp|P53492|ACT7_ARATH RecName: Full=Actin-7; AltName: Full=Actin-2 >gi|1049307|gb|AAA80356.1| actin-2 >gi|1943863|gb|AAB52506.1| actin7 >gi|9758959|dbj|BAB09402.1| ACTIN 2/7 [Arabidopsis thaliana] >gi|17065252|gb|AAL32780.1| ACTIN 2/7 [Arabidopsis thaliana] >gi|17381048|gb|AAL36336.1| putative ACTIN 2/7 protein [Arabidopsis thaliana] >gi|20465865|gb|AAM20037.1| putative actin 2/7 protein [Arabidopsis thaliana] >gi|21387189|gb|AAM47998.1| ACTIN 2/7 [Arabidopsis thaliana] >gi|21539569|gb|AAM53337.1| actin 2/7 [Arabidopsis thaliana]
Score 1417
Evalue 6.42569e-155
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13447
acgagggaCACGCCCACTTtccacgCCCCCGTCTCCGCCTCCCTCGCCAGCGAGCTCCGCTCCGCTCCGCTTCCTCCTCCGGCCCCCGCCGCCGCCTCCT
CGCTCCCCAAGACCAATGGCTGACGGCGAGGACATCCAGCCACTTGTGTGTGACAATGGCACTGGAATGGTCAAGGCTGGTTTTGCTGGTGATGATGCCC
CAAGAGCAGTTTTCCCTAGTATAGTTGGCCGCCCTCGGCACACAGGTGTCATGGTTGGAATGGGCCAAAAAGATGCCTATGTGGGTGATGAAGCGCAGTC
AAAAAGGGGTATCCTGACCTTGAAATACCCTATTGAGCATGGCATTGTGAGCAACTGGGATGACATGGAGAAAATCTGGCATCACACCTTCTACAATGAG
CTGCGTGTTGCCCCTGAAGAACATCCAGTTTTGCTGACAGAAGCTCCTCTGAACCCAAAGGCAAACAGAGAGAAGATGACCCAAATCATGTTCGAGACAT
TCAATGCCCCAGCGATGTATGTGGCTATTCAAGCTGTTCTTTCTCTATATGCCAGTGGTCGTACTACAGGTATTGTGCTTGATTCTGGTGATGGTGTGAG
CCATACTGTGCCGATCTATGAGGGATATGCACTT*CCTCATGCTATTCTCCGGCTGGATCTTGCGGGCCGTGATCTGACCGACTCCCTGATGAAGATCCT
CACGG*AGAGGGGCTattccttcacCACAACTGCTGAGCGGgaaatcgtaagagatataaaggagaagctcgcctacgtcgcccttgactacgagcagga
gctggagaccgccaagagcagctcgtccgtcgagaagagctacgaactgcctgacgggcaggtcatcacgatcggcgccgagaggttcaggtgcccggag
gtgctgttccagccgtcgctgatcggcatggaggctcctgggatcc
page-top