Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13438  (registered. 2007)
Contig Information
Length 769 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Xylose isomerase >gi|1296809|emb|CAA64545.1| xylose isomerase [Hordeum vulgare subsp. vulgare]
Score 942
Evalue 5.37714e-100
Total Hit Count 355
Registered year 2007
Contig Sequence     [ Download ]
>Contig13438
ctgcaggcaattcggcacgaggcTGATCTGAAGGAGAAAAGAAAACACTTCAGCCACTCTCCCTAATCCCTATCCGGCCCGCTTAACCATCCCCGCACGG
ATCGCGGAGCTGGTTGCCTCCCACTTCTCCGGCGGCCGCCGCGTTGCAGAGACGTTTCAGTATGAGGAAGGGCGCGGAGCTCTTGGCCCTGCTGGTGGCG
TCGTCCCTCTGCCTGTCTGCTGCGATCGCCGCCCAGGAAACCTGCCCGGCCGACATTGACGCCAAGTGCGGCGATGCCGCTTCCGATGGTTGGGAGGGCG
AGTTCTTCCCCGGCATTACCAAGATCAGATATGAGGGTCCAACCAGCAAGAAGCCGCTTTCTTACAAGTGGTATAACGTGGAGGAAGTGATTCTTGGAAA
GAAAATGAAAGACTGGCTGCGGTTCAGCGTGGCGTTTTGGCACACTTTCCGGGGTACTGGAGGAGACCCTTTTGGTGCGGCTACGAAGAACTGGCCTTGG
GAGGATGGCACCAATTCCTTGGCCATGGCTAAGAGAAGAATGAAAGCTCACTTCGAGTTCATGGAGAAGCTTGGAGTTGAGAGGTGGTGCTTCCACGACA
GGGACATCGCCCCTGATGGCAAAACACTCGCGGAAACAAATGCTAACTTGGATGAGATAGTTGAGCTGGCAAAGCAACTCcagagtgagaccaatataaa
gccattgtgggggactgcacagcttttcatgcatccacgttacatgcacggagctgctactagcccaga
page-top