Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13375  (registered. 2007)
Contig Information
Length 1332 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16154 [Oryza sativa Indica Group]
Score 1543
Evalue 2.63714e-169
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13375
gattcgtgatataggcctgcatctttctcagccgtcctcttctTCCTTCCTGCTACTGGTAACCTACGAGAGGGTGTTGGCCCCCAATGGCGAGGGCTCC
GGTGCTTCCCGCGCTCTTGTGCCTCGCGGTCCTCGCGCTGGCCGGCGGCGCCGATGCGAGGAGGAAGATGGTCGGCGTGTACGAGCTCAAGAGAGGGGAT
TTCTCCGTCAAGATGACCAACTGGGGCGCCACCATCATGTCGGTCCTCGTCCCTGATTCCAAAGGGAATTTGGCTGATGTTGTGCTGGGCATGGACACCC
TCGCTGAGTATGTTAATGATACCTCTTACTTTGGGCCGCTAAATGGGAGGGTGGCGCAGAGGATGGCCAGGGGCCGCTTCGTCCTCGACGGAAAAGTGTA
CCATACCTACATCAACGACGGAAAGAACGCAATTCATGGTGGCAAAAGAGGGTTCAGCAAGGTCATATGGACGGTGAAAGAGTACGTCGCCGGCGGCGAC
TCCCCATACATCACCATGTACTACCGCAGCTTCGACGG*AGAGCAAGGGTTCCCCGGAGACCTGGACGTGTACGCGACGTACCAGCTGACGGGCCCGTAC
GAGCTGAGCATCCGCACGAACGCGACGGCGCTGAACAAGGCGACGCCGGTGAACTTCCTGCAGCACGTGTACCTGAACCTGGGCGGGGAGGGCAGCGGCG
ATATCCTGGGCCACACGCTCCAGCTCTCCGCGTCCCGGTACACCCCGCTGGACGTGGAGATGCTCCCGTCGTCGGGCCGCGTCGACCCCGTGGCCGGCAC
GAGCTACGACTTCCGCACGCCGACGCCCATCGGCGCGCGCATCCGGCAGGTCATGGGCGGCAAAGTCTACGGGTACGACATCAACTACGTCATCGACGGG
GAAGGCATGCGGAAGGTGGCGGCGGTCCGGGACGGCAAGTCCGGGCGCGCGCTGGAGCTGTGGGCCAACCAGCCGGCCATGCAGCTCTACACCGGAAACT
TCCTGAACCACACCAAGGGGAAGGGCGGCAAGCTGTACGAGCAGTACGGCGGGTTTTGCCTTGAGACCCAGGCGTACCCGGACGCCGTGAACCACCCCGA
GTTCCCGTCGGTGACGGTGAGGCCCGGCCAGGTGTACAAGCACGACATGCGCTTCACGTTCTCCTTCTAGCTAAGGCTGGAATGAATATGGCTGCGGTAC
GGTAGTACCACCATTGGTTAATGGATCGTAGATGTGTTCCCTCTGGATTTGGAGGTGGCGCGATTCGTGGGACTGGA*TGCGGTTATGCCGTGAGCCCAG
AGCGGCTACGGTgtttaaaaataaaatcatgc
page-top