Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13372  (registered. 2007)
Contig Information
Length 1000 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Emr1 [Triticum aestivum]
Score 1218
Evalue 8.41204e-132
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13372
accgaagttcagaCATAAAGCACAACAAGATGACATTACAGTTAAACATGTTCAAgaagGGATTCGACACTTGCTCCCCAGGCAGTCATTAGGTAGTGGT
GTAAAACATGCTACTGACACTTGACACTCAGACAAGTT*CAGGTTTCCTAATCATGGCCATATAACCACCCATACATGTTCCATCAAGTTCAGGATTCCT
AATCATGCACCACATATGGTCTTGCATCTTTAGATGTCGTTATGCAGAAGGCAAATCTCAGATAGCTGTGAATCTTCACGGCCTGGAGCTGGAGGCCTGG
AAGGTGCCTGGCCTATGTTTCTCCATCAAACCGGTGAGAGCGGCATCAAACTCCTTCTCGAGCTCCACCTCCTTTGCCATGTACTCTTTCTTCAGCTGCA
CCTTCTTCTCCTCGTGCGCTTTTATCAATTCGTCCCTTTCAGCCTCAAACTCCTGCACGTCCTTAACCTGGCACTCTATGAACCGCTGTACCTGTTCCTT
CCTTAGCCTGCGATTTTCAGTAGTCCCAGAATCCACATCACACTGTCTAGCCTTTGCACGCTCCTCCTGCAGCAACCTCTCAAACTCGCTTTCCTTGTCT
TCTGTGGCCTTGTGAATGTTCTCTATCTGATCATGGAAGAATTTTTCCTGGGATTT*CATCTCTTCCTCATACTCAGAGTGCTTCTCTTTAGCTTTACTC
CTGACGAATATATTCTCTTCCATAGTCTCTCGAAGTTTCTGCGTAATAACACCCAGGGTTTCTTCTACAACTTTAGAGCGCTGCTCTGTCTTAACCACCT
TGTTCTTCAGATAATTGAGTTGTTGATTATCTTCGCTCATTTGCTTCATCTGGGCCACTACCATCTCATTATGagatctcatctcgtatttcaggcggct
tttcccttggcagtgtctattgaaagtctccatgtcttcctttctggctaggaaaccgtataattgtctcttcccaccaggtaagaaaggaaccctgcgc
page-top