Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13322  (registered. 2007)
Contig Information
Length 524 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit membrane protein [Zea mays] >gi|195655705|gb|ACG47320.1| membrane protein [Zea mays]
Score 231
Evalue 6.16732e-18
Total Hit Count 47
Registered year 2007
Contig Sequence     [ Download ]
>Contig13322
ggtcgccgtctcccaATTCCTCCGCAGGGCCCCCCTCCACTCCTCTGACCCTCTCCCCGTCTTCAGCCGCGTCCCGGCTGTCGGCGACCCGCCGACGTTC
CCGTCGTCGCCGTCGCCATGACTACCTCAAGACGTGTTGCTGATAGGAAAATTGCAGTATTTGAGAAGAATATCACGAAGAGGGGTTCTGTTCCCGAGAC
AGTCAAGAAAGCAAATGATTATCCTGTTGGACCTATCGTGCTTGGTTTTTTTGTCTTTGTTGTTGTTGGGTCATCTCTGTTCCAGATCATCAGGACAGCC
TCAAACGCCGGTCTCTTCTGAGTAGATTGGTGCTATGCTTATAGTGACCATGAACAGGGCTGTCATATGCAGTTGGTTGTCGGTTTAAAATTAGAACTGA
ATGAGATAGCTGGTACT*CTTGTGATGCTTGTTATACCT*CTTACCATTGTACTTGGTGGAGTTTAAGTTATATGGAGGTCATGCCATTGGACTGCtaat
ctgtgtttctcagggcctcaggcc
page-top