Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13282  (registered. 2007)
Contig Information
Length 851 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L9 [Zea mays] >gi|195624144|gb|ACG33902.1| 60S ribosomal protein L9 [Zea mays]
Score 855
Evalue 7.99675e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13282
ggtcacagaggagGAGGAGGAAGAAGAATCAGCGTGGGGCGAAGATGAAGACGATCCTGGCGTCGGAGACGATGGAGATCCCGGAGGAGGTGACGGTGAA
GGTGTCGGCGAAGATGATCTCGGTGACGGGGCCGCGGGGGACGCTGACCCGCAACTTCAAGCACCTCAACCTCGACTTCCAGCTGCAGGAGGGCGGGCGG
AAGCTCAAGGTGGACGCCTGGTTCGGCACCCGCAAGACCATGGCCGCCATCCGCACCGCCATCTCCCACGTCCAGAACCTCATCACCGGCGTCACCAAGG
GCTTCCGCTACAAGATGCGCTTCGTCTACGCCCACTTCCCCATCAACGCCTCCATCACCGCCGCCAACCGCGGCATCGAGATCAGGAACTTCCTCGGCGA
AAAGAAGGTAAGGAAAGTTGACATGCTTGACGGTGTGATGATCCTGCGGTCTGAGAAGGTCAAGGATGAGATCGTCCTGGATGGCAACGACATCGAGCTC
GTCTCTCGCTCTGCTGCCCTGATCAACCAGAAATGCCACGTGAAGAACAAGGACATCAGGAAGTTCTTGGACGGAATCTACGTCAGCGACAAGGGCGCCA
TCAAGGAAGAGTAGTGTTGTAGTGACCTATCCATCCGCACCCCCTTTGTAGCTGGTAGCAGAAACTGTCCTAGAGTTCTTGGAGCTTGTCGAAACCAAGA
TCAGAAGCTGTTTCTTCTTCTCTTTTTGGCTCGAGTGAATCAAGAAAAGTTTGCAGCAGTTTTGTACCGGATCGATGTATAAGGGATGTCATGTAATTGG
AGCTTGGAGATGCTgttttgacctgcnnataagacctncttgttatctatg
page-top