Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13281  (registered. 2007)
Contig Information
Length 1001 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 3
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35453 [Oryza sativa Indica Group]
Score 426
Evalue 5.81767e-40
Total Hit Count 110
Registered year 2007
Contig Sequence     [ Download ]
>Contig13281
gatgatgatgaattagTTGCAGGatttgctgctgctcacAGGCATCacagggTAGGAAACAATCCATAGCTTCAAGCACTTCCAAGTTCTTAGTAATCTT
TAGGATAAAAGAGGGTACTCCTTAGCACAGGGAGAACAATAACAGGAAATCATCTAGCGTTCAGGAAATCAACTCATACATTCGCGATACATCTCTTGAA
AGGGCGCTCGGCACACGAAGCCAGGGCTGCAGTGAAAAGGACATGATATGTGGGCAGAATTTGGCCGTATCTGGCGCCTTCTCCAGTTCTTCAGGATCGG
CGCTTGTCGCCGTGCTTCTTGCTCTTCTTCCGGCTGCCTTTGCCGTCAGAATCGGAATCAGACTCGGACTCAGATTCAGAT*CCAGAGGAGGAGgaCGAC
GTGctatccctacggtgCCTTCTCTTcttctgcgtcGTCTTGCGTCGGCGCTTCTTCTTGTCCTCCGAGTCTGAGGAGCTGTAGCTTGAGCTGCCGCTCT
CGGAAGAGTACTCGGAGCCGCTCCCCGATGATTCAGAGTCTGAGTCTGAGTCAGACACCGACGCGCGATGTTTCCTCTTGCTCTTTGACTTGCTCCTTGC
CTTCCTTTTCTCAGACTTTTCCTTCTTCAGCTTTTCTCGCATCATCTTCCTTTCCTCCTCCATCTCCTTCTCCAGATCAGGGTTCACAAACTGAGAGGGC
GCCGGCAGCCACGCCTTCTTCAACCtgggggtcCTTAAGCTGATCCGTCCTTgagggccgcgaTATGTAgacccgTTCATTCTTGCACTCGTATGTCCAG
TGCCCAGGCtggaagCACTTCTGACATTGGCCCCCAGCAGTTGCAGAAGCTGGTGCAGCATTTGGCCTCACACCCAGCCTCACAGCcttctcTGTACTCA
TCAGatacatctgcctcttggcttccttcctctcctgccagcgacttggtccctcttccttctgcccataggcattgacattgcgagcggcagcttccgc
c
page-top