Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13143  (registered. 2007)
Contig Information
Length 920 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ripening regulated protein [Oryza sativa (japonica cultivar-group)] >gi|108710167|gb|ABF97962.1| expressed protein [Oryza sativa (japonica cultivar-group)]
Score 552
Evalue 1.2377e-54
Total Hit Count 295
Registered year 2007
Contig Sequence     [ Download ]
>Contig13143
gcATCTATCCTCCACAGACCTGAAAAAA*GAAGGACCGCTAATTCTTCAAGTGCACATGAGTATGATCCTGCCATCATGTCAAAGAGAAACCGGGAGGTG
CTCAGCATACATGTCCGACATCTTCTTGCCACATAACACCGATAACCAAGTCGGCCACAAACCACAACTCATGGCTACTAGATTCAGATTTCAGAACCCT
AGCTCAGCGACGACCAAAGAGTAGTAATCGGTAGATAAGAAGACATGGCACCATGTCACAAGTCTGGTACCACCATCCCAGGTTTCTAGCGCTAACGGTT
ACTTGCTATATAGCGTTAACGATTGCCTACTTGCTACAGCAGCACAACCTACTTCCTTCATATATCCTGCCTGCTCATTTCCCTCTCAGCTTCTCAAGGT
CAGGG*AGATACAGCATTCCATCATCAGCATCGCTTTCGTCATTTTCCTCACCACCATCAAAGTCATCGTCTGAACCCGAATTCTCAGACTCTTCATCCT
CATCGCACCATTTGTTCCAGTCAACTTTGATGTATGGATGTTTTGCCTCTGACTTCAGCAAGCGCTTCCACCAACATTTCTTATCTTTCTGGATCGAACA
GATTATGTTTCGCGAACCCACCTTTGTCTTTGTTTTGCTTCCCTCAGGCAGTACGGAATCAAATAGCTCCAAATTCAAGCTAAAAGATTCCCCATGAGCA
ACAGCTGAGAAGCTAAAGATTCCCTGAGGTTCAGTCTTGATCACAACATCTTCTGCGTCTGGGACTGAGATAGTCAGGTAAACCTTTTCCGAGCGTTGAG
CCCAGAGCACCTCAGGTTGACGACTCATGGCGACGCGGCGGCGGGCGGCGGGCCGGGGAGCGAGGAGGAGGGGTAGGGTTTGCGGGGCGCGGCGGCGGCA
GGGGAGAGGAGAGGACGatc
page-top