Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13086  (registered. 2007)
Contig Information
Length 797 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216946 [Zea mays] >gi|194697160|gb|ACF82664.1| unknown [Zea mays] >gi|195625932|gb|ACG34796.1| guanine nucleotide-binding protein beta subunit-like protein [Zea mays]
Score 816
Evalue 1.72884e-86
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13086
ttttttttttgGCAgtatATTGAAAGCAGCAAAAACCCTGGTGCGAAACAG*ATCGTCTTCCATAGTACCTCATAATGTGCTCATCAACAAATCACCTAA
GCAGAAAGTAAACAGTAACTCAAGCTGAAAGTACCAGGCAGACAATGTTGCCTCAGAACAGTCAAAAACTTGACGGGCATTACAACCTCTCTGGCCAGCA
AGACCCCTACGCGTATCCGGCGAACCCGGCTTGGATCTTGAAGACCCTGATGGTCCCGTCGGTGTATCCGGTGTAGAGGGTGCTTCCGTCCGCGCTCCAG
CTCAAGCTTGTGCAGTACAGCATCTGGTTCTTGGAGACCTGCACTTCTGGCTTGAGGTCCTGCACGACATGCTTGGACTCGAGGTCCCAGATCTTGACAG
ACTCCTCTGTCGCAGCGCAGAGCCAGTAGCGGTTGGGCGAGAAGCAGAGCGCATGGATGATGGAGCCGGCTTCCAGCTGGTACAGCCTCTTCCCCTCGGA
CAGGTCCCAGAGCAGCGTGACGCCGTCCTTGCCGCCGGAGGCGCAGAGCGAGCCATCGGGGCTGACGGCGACGGCGTTCACGTAGCCACCGTGGCCGGCG
AGGGTGGAGCGGAGCTTGCAGTTGGTGAGATTCCAGACCTTGACGGTCTTGTCCCAGGAGCCGGAGACGATGGTGGGCTGCTGGATGTTGGGGGAGAACC
TGACGCACGAGACCCAgcccggtGTGGCCCTCGCcgccgcccatgtcgccgccgatggtgtacttgcactcgccgagggtgttccctcgtgccgaat
page-top