Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13077  (registered. 2007)
Contig Information
Length 840 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-gliadin [Triticum aestivum]
Score 586
Evalue 1.20371e-58
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13077
ctGTGTTTGTCTTTTattncccagTTTGAACTAGTATAGTTCGGGTTCTTACCTGATAGTGCATGTCACATTATTTTTT*CACCGCTACAACGACCAAAC
CATGGACTGAGAAAACGGTGTTTCATATATCTAGTACTAGAGTTATTTTCTTCTCAGTTAGTACCGAAGATGCCAAATGGCGCGATGGTGCAATATGGAG
GGATGTAGACATTGCACATTGCGGGTAGCGTCTGTAGCGCTAGGTTCCTTATTTCCTCGAACTGGGGCAGTTGTTGAGGCTGGACAGAGCCCCGGGCCTG
TGGGTTTTGCTGAGATGGCCGGAAGGAGCCCTGGCCTAATGGATATTGTTGCAGAGGCTGTTGGAAGGAGACCTGGCTCGATGGTTGTTGTTGTGGTTTT
TGTTGTTGATGCAGAATAATAGCATGAACAACATTGTGGATGGCCTGGCACTGCGACTGCTCAGGGATCTGCCATAGGTGCTGACAACACAATTCTTGTA
ACAGCTGGTAAGTACTTTGTTGCAAAACTTGTGATCTTCCATGCGCTATGTTGTGTTGCTGCAATACAACAT*CCATGCATGGAATCAGTTGTTGTTGCA
AAATTTGTTG*AAGGATTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGTGAAATTGGTTGTTGTGGTTGCGAATACTGTGGTT
GC*GGTTGTGGATATGGTTGTTGTGGTCGAAATGGTTGTGGCTGCGAATATGGTAGTTGCGGCTGCGGAAATGGTTGTAGTTGCAGATATGGTTGTTGTG
ATGGAAATGGTTGCGGCTGTGGAataggttgttgtggtgg
page-top