Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13023  (registered. 2007)
Contig Information
Length 1471 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05001 [Oryza sativa Indica Group]
Score 1789
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13023
ggtttttcctccggggaggtttatatttggacctgatgcgagatccttgtttgtcaccatgttcctcattatcgctccagtaacagtcttctgtgtgttc
gtcgcgaaagaattgatgaatagcttctcttatggcctggggttaccggtgatggttgtggcagttgtattcacggcatatgatttgagtcttctatttc
tcacttctgggagggatccaggaatcatacctCGAAATGCACATCCTCCAGAACCTGAAGGTTTTGAAGGCAATGCTGAAGTTGGAGCTAACCAGACTCC
ACCATTGCGTTTGCCCCGAGTGAAGGATgttgtTGTGAATGGAATCACTGTGAAGACAAAGTACTGTGACACCTGTATGCTGTACCGGCCTCCTCGATGC
TCCCATTGCTCTATCTGCAACAACTGTGTCGAGCGATTTGACCATCACTGCCCATGGGTTGGGCAGTGCATAGGACTTCGGAATTACAGGTTCTTTTATA
TGTTCGTCTTCTCGACGACTCTTCTCTGCCTCTATGTCTTTGGATTCTCCTGGGTGTACATTATTAAGATCAGAGATGCGGAGCAGATAACAATATGGAA
GGCAATGGCAAAGACCCCTGCGTCTatCGCTCTGGTTGTCTATacATTTATCGCGGTTTGGTTTGTTGGTGGCCTCTCAGTGTTTCACTTGTATCTCATG
AGCACTAACCAGACAACATATGAGAACTTCAGGTATCGCTATGACCAACGGGCCAACCCATACAACAGAGGGGTCGTGGAGAACATCAAGGAGATCTTCT
TCACGCCGATCCCTGcttccagaaacaacttcggcgccagagttccacaggagcagggcctgaggcctcgctcgacgaacggtttcatgagcccaaacat
ggggagagctgtgggcgacatcgagatgggcagaaagccagtggcatgggacgagccaaggatggcagccgagataggcgatctgggaggtctgggcaac
ttgctggaggacaaggatggcAGGTTCCGCAATGCATCACCTGATCTAAGCCGCGACGCCCTCGTGGTCGGAGGCTTAGATGAGCAAGGCTCCTCGGTGA
TGAACCCACCACGGACGAGCTGGGGAGTCGAAGCGGGCAGGTGATGGTAACTGGCAAATGTGGCCATGTAAGCAGCTATAGTGGAGGACTAAGGGGTGTA
TGTTAGTGCCAGCTTGTTCCTACTTTGGTGTCCGGTTGAGACTTGGGGTCGCTGATGTTGTTATTAGGCCTATGACCTGTTGTTGTTTTGCTTTGCACTT
CATGTATCAGTGATTTTTAAGCAGATTGTTGGTGTGTGAGGTCTCCAGTTTAGTGGAATCCTGATTGTgtcctGTATATAGTTTGGAGTGGTGAACCCga
aaatggattggtttgctttgccttcctttgttgaagattgtgaaacggcattgtacctttcaaaaaaaaaa
page-top