Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12972  (registered. 2007)
Contig Information
Length 721 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin 2 [Deschampsia antarctica]
Score 653
Evalue 1.5402e-66
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12972
aacaattccatccaagtacaGGTGACAGCTGACTt*acAAATGCGTCAATTACATGGCACTTCAatcaacCGGCAAATTCACAGATCTAGGTCGGCAAAC
AAGTTCTGGTAGAAATGGCCTTTACGGTCCACGTCGAGGTTGCATCTACTGACCGCCCCTCAGAGCAAGCACAAGATGGAGCACTGAACCACCTTCGATG
TTGTAGTCCTTAGCAGTTTTGTCATCAGCGAG*TTGCTTCCCAGCATAGATGAGCCTCTGTTGAACAGGTGGAATACCCTCTTTCTCCTCAACACGTTCC
TTGATTCTGTCGATTGTGTCAGTGGGCTCAATATCAATCTCGATTTCCTTCCCAGTAAGTGTCTTCACCTTGATCATAGTTCCACCCCTAAGCCTCAGGA
CCAAATGGAGCGTCGACTCTTTCTGAATGTTGTAATCAGCTAATGTTCGCCCATCTTCCAACTGCTTTCCGGCAAAAATTAGCCTTTGCTGATCTGGAGG
AATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCGCTGCTCTCGACCTCGAGCGTGATGGTCTTGCCGGTCAGCGTCTTGACGAAG
ATCTGCATCTTCGGACCCCCTCCCTCCTCTCCGCGGGGTCGACGGATCCGCTAGGGTTTTGCGCGGAGGCGGAGACGGAGCGGAGGTTTAGGTCGCTcgc
tggtgattgattggttgcggc
page-top