Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12969  (registered. 2007)
Contig Information
Length 581 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Nematostella vectensis] >gi|156219637|gb|EDO40516.1| predicted protein [Nematostella vectensis]
Score 408
Evalue 2.41272e-38
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12969
gccaaatcccctCTCTTCCGAAGCTACTCAGCCATGTCGGGGCGCGGCAAGGGCGGCAAGGGGCTCGGCAAGGGCGGCGCCAAGCGCCACCGCAAGGTCC
TGCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCCCGGAGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCG
CGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGC*GACGCCGTCACCTACACCGAGCACGCCCGCCGGAAGACCGTCACCGCCATGGACGTCGTCTA
CGCGCTCAAGCGCCAGGGACGCACCCTGTACGGATTCGGCGGCTGAGGAGCCGCGGCGCTTGCTGGCCGGCCGTGGCGCACAAGCCCTGGCTCGCGGTCA
AGAAAGTGGAGGAGAGGAGAAAGCTGTAGTTGATCTGGGTTCCATGCCTTCTATGATTAGTAGTAATATCTGTAGTAGCAGTAGCTGGTTGTTCAATGGT
TGCTTCAGTGTTCTGAATTTCTGATGGGCAAACACTGTGTTTGCCGAGATATATGAAtCCAGAgtaacaaaatntcctaaa
page-top