Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12964  (registered. 2007)
Contig Information
Length 1005 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0278400 [Oryza sativa (japonica cultivar-group)] >gi|108707489|gb|ABF95284.1| ARF GAP-like zinc finger-containing protein ZIGA2, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548197|dbj|BAF11640.1| Os03g0278400 [Oryza sativa (japonica cultivar-group)] >gi|125585794|gb|EAZ26458.1| hypothetical protein OsJ_009941 [Oryza sativa (japonica cultivar-group)] >gi|215697749|dbj|BAG91743.1| unnamed protein product [Oryza sativa Japonica Group]
Score 756
Evalue 3.15545e-78
Total Hit Count 101
Registered year 2007
Contig Sequence     [ Download ]
>Contig12964
aggagctggaggcgtcggcggccagcaaggaggatttttttgctaggaggatggcggagaacgagtccaagcctcaggggaTCCCTCCCTCTCAGGGCGG
CAAGTACGTCGGCTTCGGATCCACCCCGCCGCCGTCGGCGAATAGGAACAACAACGGTGCTGCCCAGGGCGATGTCATGCAGGTCGTTTCCCAGGGATTT
GGACGCCTTTCGCTTGTTGCAGCATCTGCTGCCCAATCTGCTGCTACTGTTGTCCAAGTTGGCACAAAAGAGATTCAGTCAAAGATGAGGGAAGGGGGTT
ATGATCAGAAGGTGAACGAAACTGTCAATGTTGTAACCAATAAAACTGCAGAGATAGGAAGCAGAACCTGGGGGATTATGAAAGGAGTGATGGCATTGGC
CACACAAAAGGTAGAGGAGTATGCCAAGGAAGGGGGAGTGGGCGGTGGCTGGGGTGATGATTGGCAACAAAGGGAGCAGCAGAACAACAGCAACGAG*CC
TTACCGCAGGTATGAGCAGGAGACCAGCAACGGCAACGGCTGGAATTCTCCGCAAG*ATGGATCAGCTAAGAACCAGAACCGTAATTCCAATTCTTGGGA
TGATTGGGATGACCAAGACAAGAAGGATGAGCCTGCCAAGACAAGCCAGAGCAGCGACTCGTGGGCCGGCTGGGACGATTCGAAAGATGACGGTTTTGAT
AGTTACAGCCATCACAGCCCCGCCAACAAGGGTGGGAGCAATCAGAATGGAACCGCTGGCGGGTCATATTGGGCCGACGGCGGCTTCCGCTGATGTTGGT
CTCTTTGCGAGAGCCATATACTTGCAGAGTTGTTTTATGCCAGAAAAATGTGAGCGTGCGGTTGTGGTTCTTATTTCAGGATATACCGAAGTGTTGAAGA
GTAAAAGAGTTTTGTTTTTTTGTAAGTTGTCTACAATTGTTATGCCTAGCGGCATGTTCATATGGCCAAGGCTCATTtgaaacTGCCATCCAgctatTAA
gaaat
page-top