Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9176  (registered. 2012)
Contig Information
Length 674 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 5
WH_XA Root 4
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|45645202|sp|Q96564.2|RS27_HORVU|RS27_HORVU RecName: Full=40S ribosomal protein S27; AltName: Full=Manganese
Score 183
Evalue 2.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9176
TTTTTTTTTTGAAATATAAGGCGTGCCCGCCGAGTTTGAGGGGTCGGATTTGCCATATATACCAAACACTGAACACTGTCAAGAGAATGCAGCAGGCTAT
TACTACTACATAACAAGAACCAAACTTAGATATCACCAGGCAGCCAGACAAACAGAAGCACCAACAACAGGCCACTCAAAAAGTGCATGACATAGAACAC
GTTGGTACAACGTTCAGGCTGGCAAACGGGCAAGCATAATTAACAAAATTTGACCAGTACACATTCAGGATAACTAGTTACTTGAAAAGTAAGGTTCAGC
AGGGCTTCATTTTCCCATAAACAGGCGTGCAGCTTAGTCGCCCTTCCGGCGGAAGGAGCATCCCTCGGTGAGCCTCGCTTTTCCTCCGGTGGGTTGGCAG
AGCACCGTCTGGCAGCCAGGGCACACCACCACGGTCTGAGAGTGGCTGAACACAGTTGTTATGTTGAAGCAGCCCTGGCACTTGACATCCATGAAGAAGG
AGTTGGGGGACTGCACGAGGCGCTTCTTCTTGTGCTTGAGCTTCTCGAGCTCCGCCGGCGGGTTGAGGAGGTCGATGTCGTTCTGCAGCACCATCTTGAC
GGGCGGCGGCGGTCTTCGCGTGGGAGAGGATGCGGGGACGGGGTGGCGGCGGTGGAGAGGAGCGGAGGCCGTGC
page-top