Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12791  (registered. 2007)
Contig Information
Length 905 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0466200 [Oryza sativa (japonica cultivar-group)] >gi|13489191|gb|AAK27825.1|AC022457_28 putative ribosomal protein L11 [Oryza sativa (japonica cultivar-group)] >gi|31432576|gb|AAP54191.1| ribosomal protein L11 containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639412|dbj|BAF26717.1| Os10g0466200 [Oryza sativa (japonica cultivar-group)] >gi|125575082|gb|EAZ16366.1| hypothetical protein OsJ_030575 [Oryza sativa (japonica cultivar-group)] >gi|215686598|dbj|BAG88851.1| unnamed protein product [Oryza sativa Japonica Group]
Score 628
Evalue 1.84937e-63
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12791
gcgggcgcgggagcGGCCAagg*aGTGCGACAGTGCGACCGGCAACCGGCAGCCGGCGCGGCTTGCTGTCGTCTCGGCGAAGGCGCGCCCAGATCTACTA
AAGCAATCACATGGCAACTCTGAAAGATGCAGTAGCACGGAAGCCTATACTGGCAACAATCCGCCTGCTTGTTCCAGCTGGTGCTGCACGTCCTGCACCA
CCAGTTGGTCCGGCACTCGGTTTTTATAGGCTCAATTTGATGGCGTTCTGCAAGGATTTCAATGCAAGGACCCAGAAATACAAGGCAGAAACTCCTATGC
AGGTCACGCTAACTGCCTACAAAGATAGCACTTTCGAGTTTGTAGTCAAGTCGCCGTCCGTTTCATGGTTCCTCAAGAAGGCAGCAGGAATTGAGACCGC
CAGCACTCGTCCTGGTCACAACGTTGTGTCATCCCTAACACTCCGCCACGTTTACGAGATTGCAAAACTTAAACAAGCTGACCCCTTCTGCAAGCATATG
TCACTCGAGGCGTTGTGCAAATCTATCATTGGCACAGCTAACTCAATGGGCATTGAGATTGTCAAGGATCTCTGAGTGGATTGGCTCGTCTCCAATACTA
CCAAGCTCCTACCTTCCCAGGTGACATTTGTGAGCTGTAGTTTCTCATTGATGTGGGAGAAGATGGGAGTTTTTCAACTGTTGATCCTTACTGAGCTCTT
CAGCCCAGGCAATATTTTCATTTTCTTCATACCCAGTCTTCAGCTGTTCCTGCTGCAATGTTGATCTCTTCCATGGGAGATATTTCACGGAAAATAATGT
TACTTCTAAGCTTGCGCCAGACGAACAATATTATCCATTTCTGTTACCTTGCCAAGTTGCTAGTTGTTTGTTTACTTTTGGTATCATTGTCATTT*CTCG
TGtaa
page-top