Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12715  (registered. 2007)
Contig Information
Length 900 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit spliceosome RNA helicase BAT1 [Zea mays]
Score 1111
Evalue 1.80863e-119
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12715
gaGAAATCGAACCCTATCCTCTCCTCCCCGCAGCCGCCCAAAACCCTAGCGCCGGATCTTTCTCTGCAGCTCCTCTCCCCCTACCAACCGGATTCATCCG
TCAATCCATCCATCCATGATGGGGGAGGCCAAGGAGAACGACGTGTACGAGGAGGAGCTGCTCGACTACGAGGAGGACGACGACAAGGCCCTCGACGCCT
CCTCCACCGCCAACGCCAAGCCCGCCGCCGACGCCGCCCAGGCCAAGAAGGGCTACGTCGGCATCCACAGCTCCGGATTCCGCGACTTCCTCCTCAAGCC
CGAGCTGCTCCGGGCCATCCAGGACTGCGGATTCGAGCACCCCTCCGAAGTGCAACATGAGTGCATCCCTCAAGCAATCCTCGGAATGGATGTCATCTGC
CAAGCAAAATCTGGGATGGGGAAGACTGCTGTCTTTGTCCTGTCGTCTCTCCAGCAGATCGATCCTACTGCTGGTCAGGTGGCAGCGCTCGTATTGTGCC
ACACCAGAGAGCTGGCTTACCAGATTTGCAACGAGTTCGAGAGGTTCAGCAAATTTCTGCCCGAATTAAAGGTTGCTGTATTCTATGGAGGTGTTCACAT
CAAGAAACACCAGGATTTGCTCAAGAACGACTGCCCCCACATTGTTGTGGGCACACCTGGGAGGATTCTAGCTCTAGCTAGAGACAAGGACctttcTTTG
Aagaatgtgaggcatttcattcttgacgagtgtgacaagatgcttgagtcactggacatgcggagggatgtccaggagattttcaagatgacacctcatg
ataagcaggtcatgatgttttcggcaactctcagcaaggagatccgtcccatttgcaagaaatttatgcaagatcctatggaaatttatgttgatgatga
page-top