Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12683  (registered. 2007)
Contig Information
Length 733 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 16.9a kDa heat-shock protein [Triticum monococcum]
Score 607
Evalue 3.41571e-61
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12683
cctagtcctacctacgatctacagaatTTTCCGAGCGCACAAGCCgaagcaATCAACACCGACGATGTCGATCGTGCGGCGGAGCAACGTGTTCGACCCC
TTCGCCGACCTCTGGGCGGACCCCTTCGACACCTTCCGCTCCATCGTCCCGGCGATCTCTGGCGGCAGCAGCGAGACGGCCGCGTTCGCCAACGCCCGGA
TGGACTGGAAGGAGACCCCCGAGGCGCACGTCTTCAAGGCCGACCTCCCCGGCGTGAAGAAGGAGGAGGTCAAGGTGGAGGTGGAGGACGGCAACGTGCT
CGTCGTCAGCGGCGAGCGCACAAAGGAGAAGGAGGACAAGAACGACAAGTGGCACCGCGTGGAGCGCAGCAGCGGCAAGTTTGTCAGGCGGTTCCGGCTG
CCGGAGGACGCCAAGGTGGAGGAGGTGAAGGCCGGGCTGGAGAACGGCGTGCTCACCGTCACCGTGCCCAAGGCCGAGGTCAAGAAGCCCGAGGTCAAGG
CCATCGAGATATCCGGCTGAGTATTTGGGTCAGAGCCAGTCTGGTT*CATGTGTGTGCAAGTTCTGCAGCCTAAAAGTATGCTACAGTTGTGTCTTTGTT
CTCGCCGAGT*CTGGTGAGGCATTTGGT*CT*CTGTATTGCGTTT*CTTTT*CCCTGTTGCGTCTGTACTTGTGTAATCGCCAACAGatttggcgatgaa
taaatgagaaataaattgttctgaaaaaaaaaa
page-top