Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12654  (registered. 2007)
Contig Information
Length 652 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipoxygenase [Hordeum vulgare]
Score 726
Evalue 4.2943e-75
Total Hit Count 337
Registered year 2007
Contig Sequence     [ Download ]
>Contig12654
ttttttttttactagaaagaatgcacgcagtgCTTattcatgCCTCATTGTCCTCTCCCTATCAACACCCCTG*ACAAACTAATTACCGCAGCCAGCCGG
AAGCCAATGAA*AAGTAACACAATACACCCTGCGAGACAGGAATCAACCAACGGCCGGCGGACGTCCGTCTACTGAGAAAGAAAGAGTACACTCAGATGG
AGACGCTGTTGGGGATGCCCATGGCGGTGAGCCCCAGCCCTTTCTCGCCGTCGACATCCGACGTGTTGGGGTACAGCAGCATGTACGGCATCTTCACCGG
CCCGTTCCGGTTCTTGAGCGCCGGGTCCTTGTTCATGTCCAGGATCCGCTTCTCGATCTCCATCAGCCGGGTGCCGAACCTCTTGAACGCCTCCAGGGCC
TTGGCGTCCGACGTCCACTCCGGCGTGTCACGCTGCCCCAGGTACACCTCGTCGGAGGAGTGCTTGGACAGGATCTCGATGAGCGTGATGCCCAGGATGG
TCTGGAACTGGCTGGTGATGGTGTGGATGAACACCTTGTCGGCCTCCTTCCCGCCCTTCTGCAGCTGCTTGTACTCCTCTTCGCCCTCCTCCGGCATCTT
CCGACGGCTCACAGtcggccggttcgggaggtacccagcgtacgggtactgc
page-top