Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig915  (registered. 2012)
Contig Information
Length 1203 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 1
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125535694|gb|EAY82182.1|| hypothetical protein OsI_37384 [Oryza sativa Indica Group]
Score 559
Evalue 3.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig915
TTCGGCACGAGGCCGCAAGCCGTCCGCCTCGCTCTTCTCCCGAGCCTGGTCCTCATCCTCTCGCCTCTCCTCCTCAACACAGATTTAACAATCTAGAGTT
AGCGCCTCCGTCCGTCTCGTAGCTGCTCAGATGGCGATCAAGAGGACCAAGGCCGAGAAGAAGATCGCGTACGACCAGAAGCTCTGCCAGCTGCTCGAGG
AGTACACCAAGGTGCTCATCGCCGTCGCCGACAATGTCGGCTCCAAGCAGCTCCAGGAGATCCGCAAGGGTCTCCGCGGTGACTCCATCGTGCTCATGGG
CAAGAACACCCTCATCCGCCGCTGCATCAAGGTGCACTCGGAGAAGACCAGCAACAAGGACTTCCTTGAGCTCAGCAACCTCCTCGTCGGTAACGTTGGC
CTCATCTTCACCAAGGGTGACCTCAAGGAGGTTCGCGAGGAGGTCGCCAAGTACAAGGTTGGTGCTCCTGCTCGTGTTGGGCTAGTTGCACCTGTTGATG
TGGTGGTTCCCCCTGGCAACACTGGTCTGGATCCCTCCCAGACGTCCTTCTTCCAGGTGCTTAACATTCCCACCAAGATTAACAAGGGTACTGTGGAAAT
TACTATCCCAGTGGAGCTAATCAAGAAAGGTGACAAGGTGGGCTCCTCTGAGTCTGCCCTGCTTGCCAAGCTTGGTATCCGCCCCTTCTCATATGGACTG
GTCATCTGCAATGTCTATGACAGTGGGTCAGTCTTCAGCCCTGAGGTTCTTGACCTCACCGAGGAAGACCTGATGGACAAGTTTGCATCTGGTGTTTCCA
TGGTTGCTTCACTGTCCCTGGCGATCTCATACCCCACCATGGCTGCTGCGCCTCACATGTTCCTCAACGCATACAAGAATGTTCTTGCGGTTGCTTTGGA
GACAGACTACTCATATGACCATGCTGATAAGATCAAGGAGTACCTCAAGGACCCCAGCAAGTTTGCCGTTGCTGCCCCTGCTGCTGCTGCCTCTGGTGGT
GCTGCCGCCGCTGCCCCCAAGGAGGAGAAGAAGGATGAGCCCGAGGAGGAATCAGATGGCGAGATGGGATTCAGCCTGTTCGACGACTAAGCTGTGTGCC
TATCTTCATAAAGCCGTGTCCCGTTGCCAGTTTTGTTTAGTGTTGAACACTAAAGTTTTTCAGTCCTATCATTACCTTGAACAAGAATTAATTATGCTGT
TTG
page-top