Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12593  (registered. 2007)
Contig Information
Length 721 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0092E01.10 [Oryza sativa (indica cultivar-group)] >gi|125548889|gb|EAY94711.1| hypothetical protein OsI_16489 [Oryza sativa Indica Group] (no hit)
Score 348
Evalue 6.21948e-35
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>Contig12593
cagacggcagcagataaggcAGCGGCAGCGAAGGATGCCGCCGCTGAGAAGGCCCGCGCCGCGAAGGACGCGGCGTGGGAGACGACGG*AGTCCGCCAAG
GACGCCACATGGCAGGCGCAGGAGAAGCTGAAGCAATACAACGACGTCGCGTCGGAGAAGGCCGCGAACGTGAAGGACGCCGCTGCGGAGAAAGCCGGCG
CGACCAAGCAGACGGCCGCGGAGAAGGCAGCGGCAGCGAAGGATACCGCCGCGGAGAAGGCCGCGGCCGCCAAGGATGCCGCGTGGAAGAACGCCGAGGC
GGCCAAGGGCACTGTCGGGGAGAAGGCAGGGGCGGCCAAGGACGCCACGTTGGAGAAGACGGCGTCGGCTAAGGACGCCGCGTGGGAGACGGCGGAGGCG
GCCAAGGACACGGCCTGGGAGACGGCGGAGGCGGCCAAGGGGAAGGCCAACCAGGGGTACGAGAAGGTGAAGGAGAAGGTTGGGGAGGTGAAGGACAAGG
TCACCGGCGCGGCAGCCGACGGCAAGGGCAAGAAGCACCGCAAGGACGACGAGCTGTGAATGAGCACCACCCCTCTGCATTTCTTGCCACAGTTCTTCTT
CCATGAATGTTTTCAGTGTTCGAGCTAGTCTTTTTTTCCTTGTGCTGTTCCTCTTGTACAATAATGTGACCATCTGTAGAGAACCCTCCACGATCAAACA
AGTTCCTTTTgaaaaaaaaaa
page-top