Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9138  (registered. 2012)
Contig Information
Length 1504 bp
Clones alternative view 87 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_EM Dormant seed with water absorption 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 9
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 8
WH_XT Roots, 18 day old plants were grown hydroponically 12
WH_XA Root 10
WH_XB Root 9
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|19880505|gb|AAM00368.1|AF366564_1|AF366564_1 aquaporin PIP1 [Triticum aestivum]
Score 593
Evalue 2.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9138
GCTACTGAGGAAGAGCCCCTCGGTCCAGAGCATCATTAGGGCTGAACAAGTATAAGACACAGTGCAATCAGGAGCTTCCATTGCCCACAAACATAGCAAA
TGCCGCCATTAAAAACCAGCGGCCACAAAGGGAGCACCAACTATCAATCAACATGACTGACTAATGGATGGACGCTAATCGAAGTCTAGGAACTCCATCC
TCTCTCCCCCACCTCTCTCCCAAAGCCAAGAGCTCAGTGAAGCAGCGGCCATGGAGGGCAAGGAGGAGGACGTGCGGCTGGGCGCGAACCGCTACTCGGA
GCACCAGCCCATCGGCACGGCGGCGCAGGGCGGCGGCGCGGACGAGAAGGACTACAAGGAGCCGCCCCCGGCCCCCTTCTTCGAGGCCGGGGAGCTCACC
TCCTGGTCCTTCTACCGGGCCGGCATCGCCGAGTTCCTGGCCACCTTCCTCTTCCTCTACATCTCGGTGCTCACCGTGATGGGCGTGGTGGGCAACCCGT
CCGGGTCCAAGTGCGGCACCGTCGGCATCCAGGGCATCGCCTGGAGCTTCGGCGGCATGATCTTCGTGCTCGTCTACTGCACCGCCGGCATCTCCGGCGG
CCACATCAACCCCGCGGTCACGTTCGGGCTGTTCTTGGCCAGGAAGCTGTCGCTCACCAGGGCCGTGTTCTACATCGTGATGCAGTGCCTGGGGGCCATA
TGCGGCGCCGGCGTGGTGAAGGGGTTCCAGACCACGCTGTACCAGGGCAACGGCGGCGGCGCCAACTCCGTCGCGCCCGGGTACACCAAGGGGGATGGGT
TGGGCGCCGAGATCGTCGGCACGTTCGTGCTGGTTTACACCGTCTTCTCCGCCACCGACGCCAAGCGCAGCGCCAGAGACTCCCACGTCCCCATTTTGGC
GCCGCTTCCGATTGGGTTCGCGGTATTCCTGGTGCACCTGGCGACGATCCCCATCACGGGGACCGGCATCAACCCGGCGAGGTCCCTGGGCGCCGCCATC
ATCTACAACAAGAAGCAGGCGTGGGACGACCACTGGATCTTCTGGGTTGGTCCGTTCATCGGCGCGGCGCTGGCGGCCATCTACCACGTGGTGGTGATCA
GGGCCATCCCCTTCAAGAGCCGCGACTAGTCAATCCAGCAGCTGCGAATGGAATCTTATCGCTGTTCATCGTCGGTCGATCGATCATGTGGTGGTGGTGG
TGGTTGCTGGTGCGCGCGTACGTGGATCATCTCTCGGCCGCGCACGCTGTAATAATCCTCCATCCGCCGTGCTGTTCCTCTCCTCGGTGTGTGTGCCTGT
CGGCAGCGTCACCTGTTCAAGTCTGCGAGCTTCAGTACCTGTTGTACTCTCCCTCCCTTTTGTATTGTACTACGCACGCGATTTAATGGAGCGTGCATAT
CTATGTAAATTACTACTATTAAGAAGGAACGCCGATCGAGTTAATTAACGATCTTCTCGCCTGGAGATGAGAATAATATAATGATTATGTGACCAAAAAA
AAAA
page-top