Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12518  (registered. 2007)
Contig Information
Length 881 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ferritin 1A [Triticum aestivum] >gi|210061131|gb|ACJ05646.1| ferritin 1A [Triticum aestivum] >gi|210061139|gb|ACJ05650.1| ferritin 1C [Triticum aestivum]
Score 951
Evalue 6.22762e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12518
tcggcacgagggtctgcggcagggtcggcggtctgctgcagggccgcggcgaagggaaggaggtgctcagcggtgtgatgttccagccgttcgaggagct
caagggggagctctcGCTCGTGCCGCAGGGCAAGGACCAGTCGCTCGCCAGGCACAAGTTCGTCGACGAGTGCGAGGCCGCCCTCAACGAGCAGATCAAT
GTGGAGTACAATGCCTCGTACGCGTATCACTCCCTCTTTGCATACTTCGACCGCGACAACGTTGCTCTCAAGGGATTTGCCAAGTTCTTCAAGGAGTCAA
GCGATGAGGAGAGAGGACACGCCGAGAAGCTCATGGAGTACCAGAACAAACGTGGAGGGAGGGTGAGGCTCCAGTCAATCGTCACACCCTTAACAGAGTT
CGACCATCCTGAGAAAGGCGATGCCCTGTATGCAATGGAATTGGCTCTAGCTCTTGAAAAGCTGGTGAATGAGAAACTGCACAACCTGCACAGTGTAGCT
ACAAGGTGCAATGATCCTCAGCTGACCGACTTTGTTGAGAGTGAATTCCTTCAGGAGCAGGTTGACGCCATCAAGAAGATCTCTGAGTATGTGTCGCAGC
TGAGAAGAGTCGGCAAAGGCCACGGAGTGTGGCACTTCGATCAGATGCTGCTTGAGGAGGCAGCTTGAAGGACACGACGACTACGGGCAATGGAGGATGT
AGGTGTGATATGTCAAGTAGTGGACAGATAAGCCAACCACTGGATGTGGTTTTCAGGGATTTTTGCAGTGGGATTTGTAGGGTACTATGCTGCGCTGTGT
TTGGGATTTGAAATAAAACGATGGGAGATGTGCCACGCTCTTAAATGCCAGTCTTCTGCTCTAATCTTGctaaaaaaaaaa
page-top