Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12500  (registered. 2007)
Contig Information
Length 838 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0480000 [Oryza sativa (japonica cultivar-group)] >gi|77555455|gb|ABA98251.1| DHHC zinc finger domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649274|dbj|BAF29786.1| Os12g0480000 [Oryza sativa (japonica cultivar-group)]
Score 768
Evalue 9.53677e-80
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12500
gccgcttcttcctccggaaaacgtcgtctccggagcaccagagtcgCGACCGCCGGTAGCCCTCCTCACTCCCGCTTAACCATCCTCGCCGTCGGATGCG
ACCGCGGCGGCCCCAATGGCGTCCTCCTCCGCCGCCGAGCCAGGCGCCCGCCTCTCCGATCGGACGAGGAGGTCGCCCCTGGGCCTGAGGGCCATGGTTC
TCCTGATGCACGTGGTCTTCGTCGGCGCCGTCTTCCTGCTCGATTCGACCCTCGATAGGCGGATCCACGAGGAGCCGTGGTATATTGGAGTGTATGGTGT
GCTTGTTCTGATCACCTTAGCGCAATACTTCTACACTGCTGGTTCATCTCCAGGCTATGTTATTGATGCAATGCAAGCCAGTGGTGGGATGCATGCAACC
TTCATCAATACTGCCACTCTTTCAAAACAATCCAGTTCAAAACATGGAAGCTTAAAGTCCTCCACAAACCGGCCTGATCTAGAGAAACTTAGACCAATGT
CTTCTTCATCGTCATGGTTGCATCAAATTGTGGATCTTTATCCTCCTGGGTCAAGCAACAGGGATTGGACTTGCCAATATTGCAAAATTATCCAGCCACC
TCGTACCAGGCACTGCCATGATTGTGATAAATGCGTCCTTCAGTTTGACCATCACTGTGTTTGGCTTGGAACGTGCATTGGCAAAAAgaaccattgtcgt
ttttgaataaatctgcatgtgtgtttattggcttgcttctggacatctggtgctgtatcaacattttgaggagcatgctctatgcatgcacactgcataa
ggctnattggtgtgactgtcaatgcatatccacccatg
page-top