Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9133  (registered. 2012)
Contig Information
Length 959 bp
Clones alternative view 93 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_r Root 5
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 5
WH_XA Root 4
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464585|ref|NP_001055892.1|| Os05g0489600 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 2.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9133
TTTTTTTTTTGGCAACCACAATTCAATCTTGCTAAAACTCAAAACGATAGGGGTTCAGACACACATTGTCGACACATTAAACCTTGTAAAACCACCGAAC
AGCAACTGATAACATCCATGCAAAAAAAGACAACCTGACCTGATACTAGCTCACTTAAAGAAGGGAGCTTCTGCCTGTCACATACGCACACATACTATCT
CTTGTACAGTGTATATATATCACAATATGTAAAATGGTAGCAGTGAGTTGTTGAGACATCCAGCACGTTTGTTTCTTGATGAAGCGCTTGTCGAGGCGCT
TCAAGCCTTGTTGGCAATGTTGTTGGAGAGCCAGTCAAGACCCTCGTACAACCCTTCGCCAGACGTCGCGCAAGTGCTCTGAATGTACCAGTGCCGCTGG
CGCAGGGAGTGCAGACCAAGCTTGTCGGTGATTTCAGCAGCATTCATGGCATTAGGAAGATCTTGTTTGTTTGCAAATACAAGCAACACAGCATCACGCA
GCTCATCCTCATTCAGCATTCTGTGGAGCTCATCTCTAGCCTCAACAACACGTTCCCTATCATTGCTGTCAACAACAAAAATGAGCCCTTGGGTATTCTG
GAAGTAGTGCCTCCACAGGGGCCTGATCTTGTCTTGGCCCCCCACATCCCAAACAGTGAAGCTGATGTTCTTGTATTCAACAGTTTCGACGTTGAATCCG
ATGGTTGGGATGGTGGTGACGATCTCTCCGAGCTTGAGCTTGTAGAGGATGGTGGTCTTACCAGCGGCATCGAGACCAACCATGAGAATCCTCATCTCCT
TCTTGGCGAAGAGGCGGCTGAACAGCTTGGTGAACGTGAGCCCCATCTCTGCTCCGAGGTGGAGACGAAGGCTTCGAGGTCTCGGCGCTCCGGTGCGGCG
TGCTCCTCCTGATCTAGGGGGAGACGGGCGTGGGAGTTGGAGCTTGGAACCGCACGGAG
page-top