Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig913  (registered. 2012)
Contig Information
Length 918 bp
Clones alternative view 155 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Wh_r Root 9
Wh_yd Spikelet at late flowering 11
Wh_CSEC Callus 11
Wh_DPA20 Seed DPA20 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 14
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 9
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_SP 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253783729|emb|CAZ76054.1|| glyceraldehyde-3-phosphate dehydrogenase [Triticum aestivum]
Score 424
Evalue 5.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig913
GACGAGGCGAAAAGCCCCACAGAAAGGAAGAGAAATAAGATTATTCAGGCAAATTTTTTTACTGGACTGAACGATTTATATAATCTTCACAAACCACAAC
CAAAAAAGAGTACTTGATTAGCAACTCCATTACAGAAGTACTAGTTGATGCGGAAAACAGAAGGTAACTCATGTCCAACTAACATGAACCAGGCGTCGTC
TGGCGACACCATCCACATTTATTCTTCGCATAGACAAAGCAGGGACACCTGACCAAAGGAAATCAGAACGCTCTACTGAGTCTTGGCCATGTGGCGGATC
AGATCGACAACGCGGTTGCTGTAACCCCACTCGTTGTCGTACCACGAGACGAGCTTGACGAAATGGTCGTTCAGAGCAATTCCAGCCTTGGCATCAAAGA
TGCTCGACCTGCTGTCACCGACAAAGTCAGTGGAGACCAAATCTTCCTCGACATAACCCATGATCCCCTTGAGTTTTCCCTCAGATGCAGCCTTTATAGC
CTTCTTGATGTCATCGTATGATGCAGCCTTCTCGGTTCTAACAGTGAGATCAACAACTGACACATCCACAGTGGGAACCCGGAAAGACATACCGGTAAGC
TTGCCATTCAGCTCAGGAAGAACCTTGCCAACAGCCTTGGCAGCACCAGTGCTGCTGGGAATGATGTTAAAGCTTGCGGCCCTGCCACCTCTCCAGTCCT
TGCTCGAGGGACCATCAACGGTCTTCTGTGTGGCAGTGATGGCATGAACAGTGGTCATCAAACCCTCAATAATACCGAAGTTGTCATTAATGATCTTTGC
TAGGGGAGCAAGGCAGTTAGTGGTGCAGCTAGCATTTGAGACAATGTTAACGTCTGAGGTGTACTTGTCCTCATTGACACCAACCACAAACATAGGGGCA
TCTTTGCTTGGGGCAGAG
page-top