Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12272  (registered. 2007)
Contig Information
Length 542 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0188100 [Oryza sativa (japonica cultivar-group)] >gi|113578390|dbj|BAF16753.1| Os05g0188100 [Oryza sativa (japonica cultivar-group)] >gi|125551118|gb|EAY96827.1| hypothetical protein OsI_18750 [Oryza sativa Indica Group] >gi|125593079|gb|EAZ33138.1| hypothetical protein OsJ_016621 [Oryza sativa (japonica cultivar-group)] >gi|215769056|dbj|BAH01285.1| unnamed protein product [Oryza sativa Japonica Group]
Score 228
Evalue 1.47932e-17
Total Hit Count 204
Registered year 2007
Contig Sequence     [ Download ]
>Contig12272
cacgaggaAAAAAAGCACTTTCCATCTCTTCTCGTTGCTGGATCTTCTTGCAGGGGAGGAAAAAGGGCCGGCGATGGACGGCGGGAAGAAGAGCCGGGAC
CCGTACAAGCTGCCGCAGGAGCGCAGGGACCGCAAGTCAGGCTCCGGGATGAGCGGCGACGCCAAGAAGGGCGGCCGTGGCGGCAAGTTCACCTGGGAGG
GCGCCGACGGCTACACCGACGAGGATCTTGACCTCATCGGCAACAAGGGCAGGGGGACCGGCGCCTCCGACAACAAGAAGTCCTAGGGAGATGGCGACCC
CTCCGACGAGTAGGCGCTACGTCATCCGGCCCTGCCCGCCCGTCTTCTTCCTGTCCGATCGATCCCAAGCCTGCACGGTGTCAACTTT*CGTTAGCTTTC
TCGTGTCTGTTATTAAATAATACGATCGAATCGTGGCCT*CTTTGGCA*TGTACGTACTATATGATCTATTTTCAGTTATCGACTTGCTAATGCCGGATG
AATTGTTCTATCTGCATCTCGCACTTGGGATcaaaaaaaaaa
page-top