Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12254  (registered. 2007)
Contig Information
Length 867 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0281300 [Oryza sativa (japonica cultivar-group)] >gi|49387862|dbj|BAD26527.1| putative fiber protein Fb34 [Oryza sativa Japonica Group] >gi|50251641|dbj|BAD29644.1| putative fiber protein Fb34 [Oryza sativa Japonica Group] >gi|113631000|dbj|BAF24681.1| Os09g0281300 [Oryza sativa (japonica cultivar-group)] >gi|215679019|dbj|BAG96449.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704195|dbj|BAG93035.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218184356|gb|EEC66783.1| hypothetical protein OsI_33176 [Oryza sativa Indica Group]
Score 807
Evalue 3.00746e-84
Total Hit Count 82
Registered year 2007
Contig Sequence     [ Download ]
>Contig12254
acgctcacaacttggatcTAGGAGCATCACAATGCCGCTGTCTTAGACATCAAATATTCTGTAGATCAGGCAAGACGAGAACTAGGCCTGAACAAACACA
TCTGATCTGATCATAGAGAGCCATACCACACGCTACATTTTCCAGAAACTACTACGTTCTGCTCCAGAATATCTAACTAAATCCAGCACACAAGCAAGTT
CCATCAAACCAGAGTCCCTTCTCCCTCGTCATGCGTAGCCAGCCATGCCGACATTGGCGGTGGCCTTGTTGGTCTTTTTGGCGGCCTGGCGCGTCGATTT
CGTGTAGTACATGTAGAAGTACACGTTCA*GGGTCATGGTGAGCACCACAAAGACCGCCCCCGAGATGAACACCCCTTTCCGGAGCGAGTCGCAGGTCCA
GCTCCCTGCGTATATCATGTGCCTGTACTTGGTGTGGTACGCGTTCTTTGTCGCCCCGGCGATCAGGCAGGACTCGGCGATTATGAATGTGATCCATGAA
GAAACAAAGTAGATAATGGACCAGGCTCTGCTTCCACCAGGTGCGAGCGGTTGGCCAAAGCACATGCACTTTGTAACTCCCATAAGGAGTGATTGGCCCG
AGAGGAGAAACAGGAAGGCGCCGACACCATAGCCGGTAGAAATATCGGAGTCATAAGTGCAATATGTGGAGTTGTTGATGTCTGTGACTATCGAACCCGT
GCTGCGGCGGCGCTCTGCGGCGATGGCGAAGCCGAAGGCGGTGAGGCAGAGGGCGATCACCAGAATGTGCACCAGCAGAGAGCTCCAGCTCCTCGTCTCC
CCCATCTCCCGTTCGCTCTAGCGTCTCCCCGCTCTGGAGCCCGGATGCTGTGAGAGTGAGAGtgggc
page-top