Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12213  (registered. 2007)
Contig Information
Length 824 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 596
Evalue 8.10602e-60
Total Hit Count 180
Registered year 2007
Contig Sequence     [ Download ]
>Contig12213
cgaggctcctccttccattcccttccccagtcacCCTGTCcgctcGCCGCCGCCGCCGCCgc*ccgACTCACCGAAGAATATACCAGCGCGCGCGCGCGT
GCTCTCTCCTCCCCCGTATCCGCCCGATCCCTCTTCCGGCCCCGCCGCGATGCTCTCCCTGTCCAGGACGCTCGCGAGGCGGCTCTTCTCCACCGCCGCC
GCCGCCTCGACGCCGCTGGCGAGGAAGGCGCAGAACCCCCTCGAGGAGTTCTTCgacgtCGAGCGGAGCACCCAGGACGACCAGCCCGCGCCCCACTACG
GTCGTGGCTGGAAGGCTTCTGAACTGCGCCTCAAGTCCTGGGACGACCTTCATAAGTTGTGGTATGTCCTGCTAAAGGAGAAGAACATGCTCATGTCCCA
ACGCCAGATGCTGGCTTCAGAGAGCATGCGTTTCCCAAACCCGGAGCGCATTTCCAAGGTAAGGAGATCGATGTGCCGGATCAAGCACGTGCTGACGGAG
CGGGCCATAGCGGACCCTGACCCGAGGAGGACTGCGGAGATGAAGCGGATGATCAACGCCATGTGACCGACCCGCGCCGCGCCGTGCTTCTACTGTCCGT
AAGCAGCAGCCGTAGCAGCATTAGCATCTATCTAGTGGAAAGAACGAATTTGCTCGCTTTTCCTTCTTGGGTTGTATGCCTCCCCCCGTGAGATGCATAA
GACCAGCAATCCTTGAGACGCCGTCGCCCCCGACAGTCCCACGGATGGGCGAACGTCAATGGACTTGTGTTCGAATAATCGCAACCGTCctttttttctt
ttgacaTGTGTGTGTGTGTGTGtg
page-top