Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9105  (registered. 2012)
Contig Information
Length 1360 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 5
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 1
WH_XB Root 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219885633|gb|ACL53191.1|| unknown [Zea mays]
Score 725
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9105
TTTTTTTTTTGATTTAGAATAATATATATTACTTAGACGTGACGACCCATAATCCACTGATGTTCCACGAATGTTAACTCGCACAGAATAACCCCGACCA
CTCGTACCAAAACAATAACCACCACAACCCAGTCTAAGATAACGATAGAACACACATAATAACTAAGAAGCAGGCTTCACCGCCTCTGCAACAGAACATC
AACTCGTTTAGTCAACTTCCTCGATCTTGGGGCCAGCACCGCCGGAAGCAGCCGGGGTGTCATCGTCCATGCCGCCCTCCATGTCGGCACCAGCACCCTG
GTACATCTTGGCGATGATGGGGTTGCACAGAGCCTCCAGCTCCTTCATCTTGTCCTCGAACTCATCCGCCTCAGCGAGCTGGTTTGTGTCCAGCCACTGG
ATGGCAGCGTCAATGGCGTCCTCGATCTTCTTCTTGTCGTCCGCCGGCAGCTTGGAGGCGATCTTCTCATCCTTGATGGTGTTGCGCATGTTGTACGAGT
AGTTCTCCAGGGCGTTCTTCGACTCCACCTTCTTCTTGTGCTCCTCATCCTCAGACTTGTACTTCTCAGCCTCCTGGACCATCTTCTCAATCTCCTCCTT
GCTCAGCCTGCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCGGTCGTCTTGTCCTCAGCAGACACGTTCAGGATACCATTGGCGTCGATGTCA
AAGCAGACAGTGATCTGGGGAACTCCCCTGGGTGCAGGAGGGATGCCGGAGAGCTCGAACTTGCCAAGGAGATTGTTGTCACGGGTCCTGGTCCTCTCAC
CCTCGTACACCTGGATGAGCACACCAGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGGGATGGTGGTGTTCCTTGGGATCAACAC
TGTCATCACACCCCCGGCCGTCTCCAGACCAAGAGAAAGAGGAGTGACATCCAACAGCAGCAGGTCCTGGACCTTCTCGTTGCCCTCTCCGCTCAAGATG
GCAGCCTGGACGGCGGCTCCGTAGGCAACAGCCTCATCAGGGTTGATGCTCTTGCAGAGCTCCTTGCCGTTGAAGAAGTCCTGGAGAAACTGCTGCACTC
TGGGAATCCTAGTGGAACCACCAACAAGGACAACATCGTGCACGGTGCTCTTGTCCATCTTTGCGTCCCTCAAACACTTCTCCACAGGCTCCATACACTT
CCTGAACAGATCCATGTTCATCTCCTCAAACCTGGCACGGGTGATGGTGGAGTAGAAGTCGATGCCCTCAAACAGCGAGTCAATCTCAATGGTGGTCTGG
GCAGTGGAGGACAGAGTTCTCTTTGCCCTCTCACAGGATGTCCTCAGCCGCCGAAGAGCT
page-top