Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9103  (registered. 2012)
Contig Information
Length 1339 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 3
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493810|ref|NP_001146931.1|| actin-2 [Zea mays]
Score 752
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9103
TACGGGCCTTTGCCAAGCAAAGCCATATAGAGAAATAGCGATGAAGTTGCAGAATCCAATAATAAATCCATCAAATCAGACTACACACATAATAGAGTAG
ATACACCCATAGACAGGCCATCGGCCTAACATTTGTCCAACAAAACCACCACCTAATAATGCTACTAGACAAGGGTATGCATGGAGAATAGGTCTGACGA
CAACTGTCTAGAAGCACTTCCTGTGGACGATAGCTGGGCCAGACTCTTCGTACTCTGCCCTGGAGATCCACATCTGCTGGAATGTGCTCAGAGATGCAAG
GATAGACCCTCCAATCCAGACACTGTACTTCCTCTCCGGTGGAGCGACGACCTTGATCTTCATGCTGCTTGGGGCAAGCGCTGTGATCTCCTTGCTCATA
CGGTCGGCGATGCCAGGGAACATGGTAGACCCACCACTGAGGACAATGTTACCGTACAGGTCCTTCCTGATATCCACGTCGCACTTCATGATGGAATTGT
AGGTCGTCTCATGGATGCCAGGAGCTTCCATGCCGATGATGGAAGGCTGGAAGAGGACCTCTGGGCATCTGAAGCGCTCTGCGCCTATGGTGATCACTTG
CCCATCAGGCAGCTCGTAGCTCTTCTCAACTGATGAGCTGCTCTTCGCAGTCTCAAGCTCCTGTTCGTAGTCAAGGGCAACATATGCAAGCTTCTCCTTG
ATGTCACGGACAATTTCCCGCTCGGCAGTGGTTGTGAAAGAGTAACCCCTCTCAGTGAGGATCTTCATGAGGGAATCAGTGAGATCCCTACCAGCAAGAT
CAAGACGTAGGATAGCATGTGGAAGGGCATAACCTTCATAGATTGGGACTGTGTGACTGACACCATCTCCAGAATCCAAGACAATACCAGTGGTACGCCC
ACTAGCATATAGAGAAAGGACTGCTTGAATAGCGACATACATGGCAGGAACACTGAATGTCTCAAACATGATCTGTGTCATCTTCTCCCTGTTGGCCTTA
GGGTTAAGAGGAGCCTCTGTAAGAAGAACAGGGTGCTCTTCAGGTGCTACACGGAGCTCATTGTAGAAGGTGTGATGCCAAATCTTCTCCATGTCATCCC
AGTTGCTTACGATTCCGTGCTCAATGGGGTACTTCAAAGTCAGGATACCCCTCTTGGATTGGGCCTCATCACCAACATAAGCATCCTTCTGCCCCATCCC
TACCATAACACCAGTGTGGCGTGGACGGCCAACAATACTAGGGAAAACAGCACGTGGAGCATCGTCTCCGGCAAAGCCAGCCTTGACCATTCCGGTTCCA
TTGTCGCAGACAAGGGGCTGAATGTCCTCCGCGTCAGCC
page-top