Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig910  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_CSEC Callus 1
Wh_VWD Shoot grown with dessication 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125546083|gb|EAY92222.1|| hypothetical protein OsI_13943 [Oryza sativa Indica Group]
Score 334
Evalue 7.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig910
TTTTTTTTTTGCAATAACAGGGACTGACTGACTGACTCTTTGTTTCTCAATCATCAACGCATTATGCTAGTACGTAAATCCATTCCACAGGAAAATTGCA
TCACACCCCAGTGCCATAATATCGAGCTAGTATCTAACAAAATCTTACACAGCAAAGAAGAGCCTTCCAGACTCTGCCTAACATTAGAGTTTACCGCAGA
GACATCATAAAACACTCAAAAGGCATGGTATCAATGCTTAATATTAGAGTTTACCATCATTACAGACCACTCAAAGGCTGCTTGGTTGGCTGCCTGGCTG
GCCCTCTAGAATCTTGCACATTGCATGTTATCGTCACCGCCCTTCCGTCCATAAGGATTTGCGGCATTGATACCATGCCTCCTCGCCCCACCATCCACTT
TCCTTGTCTTCCGACGTTTAGAAGCGCTGCTCTCCAAGTCGAGGTTCACTTTTGGAGGGTTCTTAAAACAGAATGACGCTGCTACAGCCTTCATATCAAG
ATCATGAACATTAAAAATGTCCTTCATGGCGTGTGAGTTGTATGCCAAGATGTAGGATCTGTAGGCTTCTTTAGCTGACTGGTTTAGGAAGTAATTCTCG
CCAACGATGTTCTCAAGGTGTGATTGTAAATTTGGCACATTCTTATTATTGAACTCGTATTCTGTGAGAGAAATCTTCGCTGCCTTCAGGTAAATAAGAA
ACTTCAGTTCTTGCGGCAACAAGAACAATAAGGCGCTTCCTTTGCCTTTTTCACCACGTGCAGTACGACCAACTCTGTGAATGTAATCCTTTGGTTCATC
TGGAGGGTCATATTGCACAATATAATCCACATCAGGAATATCAAGTCCACGTGCTGCCACATTAGTGCATAATAAG
page-top