Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9090  (registered. 2012)
Contig Information
Length 1171 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 3
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 6
WH_XA Root 1
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226529557|ref|NP_001149653.1|| seed maturation protein [Zea mays]
Score 430
Evalue 2.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9090
TTTTTTTTTTAACACCAAAAGAGCCACTTCATTCATTATAGCAAGTCTACTAAAGTCGCAAACATCACTGCCATATTACACCAACACGACTTGCAAGTGA
GGATGCTACGTTGAACATAGAATTGGAAACAGGATATTGAGCAAAAGCTGGCATGACTTTTAAGTTCGTAGAAGTTGCACGTCATGACTACTGACCGTGC
CAGGGTTTTGACCAGATAGTGGTATCTACTATCAGCTACGGACATGGAATCACAACCATCCTTGAAAACCGACGAGTAGTGATCAACTTTGAAAGTAAAT
CTGCGCAGGGTACTCTCTACCGTTCTAATGCTGCTTCTTATCCTTGGACGGACCCTTGGGAATCTTGGACAGGCACTTCTCATCGAAGATGGCGTAGTAC
TTCTTCAGCTCGACCATGGCCTTCTCTCCAAAAGCATCGATCTTGTCCTCATACTTCTCGTACAGAACAGGCACGGTGTAAAGCACCATGAAGACTATGT
AGAACAAGGTCAGGAAATTGCAGCAGCTGCCAAGGAAAGAGAGGATCCACAGGCCTGCAACCACAATCAGGAATTTCTTCAGGTCACGGCCTTGACCAAT
CGCCCTCAGGCTAGCAAAGCCCCTGTTGATCTCGTATCGCAGCGAGCGGGCAACATTGACAGCCAGGTCCTCGGGGATCTTCACCTCTGGAATGTTGGGA
GGGCACTTGTTGACGAAGGCAGAGGCGTTGGACCAGAGGAAGAGGATGCCCAGGGTGAGGATGAAGCCGTGGCAGAGGAGGGTGAGGAGATGGTACTCCA
GGACCTCAAACAGCAGCCAGATGGCGGTGGCGCCCGCGAGCACCCCACCGGAGATCTTCTTGTTCCTCCACAGGAAGAGGTCGGCAGGCTTGCCGCCGCC
GAGGACGGAGTGGACGGGCTTCTCGCGGCCGAAGAGGCGGTAGATCTTGGCCTTGACGGACGACGACGACCCCGACTTCCTCTCGTCGTCGTCGGACGAC
GAGGAGGACGAGGACCCGCCGTGGAACTTCTCCGTGATCTTGTCCATCACCGACTCCTCCTTGTGCTCCGCCATGGATGCTTCGCTCGCTCGCCCGCCGC
TCCCCCTCTCTCCCCAACGCGACGCTTCTGTTTGGCAACGCCTTTTCTGCCTGCCTGCCTGCCGTCGCCGC
page-top