Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12035  (registered. 2007)
Contig Information
Length 713 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003425 [Oryza sativa (japonica cultivar-group)]
Score 884
Evalue 2.47445e-93
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig12035
acataACGCGCcaagcAGGCAAATgtcacaGTTTGGCTCAACTGGTCCAGACC*TACATAAAAGACAACGATGCACCAAAAGCGTCTACTGCACCACACC
ATCTCACACAACATAACAGTTTCAGGTTTGCACTTCAGCCGGTGTTCTGCATACCGGCGGCGATGCCCTTCATGGTCAGGATGAGGGTGTCCTCGAGCCC
CGGGGCGTACTCGCTCGTCGGGTTGAGCTTCAAGAGCTCGGCGGCCAACTTCCCAGACTCCATGATCTCCTTGGACAGATGAGGCCCCGGCTGTGAATGG
AAGCTAGGGTCCCGGATACGCTTCAGTGTGTAGGCTTGGCAGACATTCAGCGTTGTGATGTAAGAATCACGGAGCCGCAGGCTCTGTCTCAGGTAAGGAT
CGCCCTCCAGGAGGTCCTTGTGCCCAGCTACCTGTAGAAGAAGTTGCTTTGTTTCTTCATAGTTTGCTCGAAGACGCTCCCCAAACGGCCATAAATCATC
AGAAACCAGCAGCTTGTCATACAGAGCAGCTATACCAGGGTCACCTTTAGCAAACACCATCTCAACCAAGTCTATTGTAACCCTGAAAAATGGCCACTCG
TTGTACATCTCCTTAAGGGCTTGAAGATTACGTATGTCCTTCTGCAGGACATGTTTGAATGCTGCGCCGAAACCAAGCCACACTGGcaagtGGAATCtgg
ttttgCGTCCAag
page-top