Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12019  (registered. 2007)
Contig Information
Length 584 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Cyan7425_2682 [Cyanothece sp. PCC 7425] >gi|219864691|gb|ACL45030.1| conserved hypothetical protein [Cyanothece sp. PCC 7425]
Score 79
Evalue 3.45834
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>Contig12019
gcGCAAACACAACTACTCCCCAGTGGCCAGCAACTCTGAACCTCCCGG*ACCAAGTTAGCAATGGCAAAGCGCCTCGCCGTCGCGCTCCTGCTGCTGGTC
CTGCTCGCGTCCAGCGACGCCGGTGCTGCTGCCCGTGCTGCTAGTGGCGTCGGCGAGAAGAAGGCTCTGGTGCCCGGGGTGGACCTCCCTCTCCCTGGGC
TCCCTGGGCTGCCTGGGCTCCCTGGGCTCCCTGGCCTGCCGGGGCTCCCTGGG*CTCCCTCCCGTTCCCAAATCCACCGCCACCAATAAGTCTCCATGAT
CGTCTATGGTGTACTACGTGCTGGCTAACATGCATGGCCGAAGCTCAACTACTTGTGGGTTTAGACTTGCAGCTAGCACGCACCGGCCGGAAGAAAATCA
CCGGCGTTTCGCTCAAGCGTCTGTACCAACTATCCTGGCGTGTGTACTTCCTTTCAGTTAAAACTATCGTATGTATTTCCTTTCGGTCCACGTAAGTATG
TTCTCCCTACTTAATGACCTCCTTGATGTGCTACATGCATCATCAACGGAATAAATAAAGGATTTGTCGACGTgaaaaaaaaaa
page-top