Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11974  (registered. 2007)
Contig Information
Length 674 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein MGG_13151 [Magnaporthe grisea 70-15] >gi|145022389|gb|EDK06409.1| hypothetical protein MGG_13151 [Magnaporthe grisea 70-15]
Score 79
Evalue 4.87996
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>Contig11974
cattagttctaaacttacagtcccaaccatcacATCATAGTTcaa*gtTTAAATACTTCAGTACAACCAACTCTAGGAATTTAAAGGACTTCACGTAGAA
ACATCTCCAAAAGACAGCCATCAAAGCATCACACCGAACAGCAAAAGACAACCATCAAAGCATCACAACGAACAACAACTCCAAAAGAAATCATCACTAG
CTCCAGCTTCCATGCTCCAAGCCTCCAACTAGCATCATTCTCCAAGCTCCAGCTAGCTCCAAGCTCCAGCAAATCTACGAGTAGAGGCTGTTGATTTCCT
TGGTCTTCTTCCTAACTAGTCGTCCAGATCTACGAGTCTCCAAATTGCCAATGCTTGCTTGTGTCTCCTTTTCAACTTGTACTTGTGTCTCTTCTTCCAC
TTGCATTTGTGTTTCTTGCTGATCTTGTTGATCATCCTCA*TCATCCTCACTCACCCCATCATCATCCTCACTCTCATTATCAACATATTCATTATCGTT
GTCGTCATCCTCACTGTCAGTTTCAACATACTCATTCTCCTCATCATGATTCCTCTTTCTTTTCTTCTTATTAGCCTTTGTACCAACATAAGAATCCTTC
CTGCTTGAGTTGAGGCGCCTTATTTTCTCAAAAACAGCACTGGCCGCATCGGCTCCATCCAAAACTGGATCCtc
page-top