Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig907  (registered. 2012)
Contig Information
Length 1393 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226316439|gb|ACO44683.1|| fructose-bisphosphate aldolase [Secale cereale]
Score 368
Evalue 9.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig907
GCATTCTTTGTGCTCATACTATTTGAATTACNNNTATCGCTCTCTAAAAACTAAAATAAAACTCATCCAATATTTGCTTACAGCAACAGAAACACAGGCT
TGGCTTTCGTTCTTACCTCAGTAAGTGATACAGGTGCTTTTTAAATAGTGGAACTCCCAAACAGAAAACTCTCATATTCAGAACTTTTTTTTTCTTGCTG
GAGGGGATCATCTTGCATCAATTGCGAACTTCAGCCTTCCATAATCAATATATCTACAGCTACAAGATAGTTTCACACCCGGTGGGAACAGAAAAGGAAA
AAAATTCTGGCACTTGCTATGAAGAGTAACTTTCAGACCAACTGTTAGAAATGATATTATTTGACTAATCCAGTAGAACTAGCCCGATGCTGCCTTCAAG
CATAGCGCCTGCGCGTTGATGTCTTGATGTGATTGTGTCCACATGAGAGCCTCAGAGCCTCTAGAAGAGGAAAGAGCTTCATCATTTCACATTTTGTTTG
ACGCCATAAATTTGATTTTTCTCTCAGCAGGTTTGAGAATTTGAAATGAACACATCAAAGTTTCATCAACACTCATCATTGCTCCAGCAAAAACTCAAAG
CATGTGTACTCAGCATATAACAGGTTTTACCACCAACTTACTATACGCAGCACTCAGGTTACACGGTATTCGACTCCAAAAACAGGATATTCATTCAACT
CCAAAAACAAAACTACCTAAGGTAAAGTTCCATGCTAGGTTCGATATCCGAAGGATATATCAGGACCCTGAAAACCAAACGATAATACTGGTAAGCAGGA
CACCCAAACGTGCCACAGCACCGAAGGTAGATCAGTACTTGTAGTCCTTGACGTGGAGGCTCTCGGAGGCGCCCTCGCCAAGGGTGGCATCGCCCTTGTA
GGTGCCGAGGGTGGCCTCGGAGTTGGCCTTGCACCTCACCAGGAACGCCTTCCTGGCCTTCTCCTCGTTCTCCGCCTTGCCAGCCCAGGCCTTGAGGGTG
CTCTGCTGGAGAGCACGCCCGAAGGAGAAGGACAGGTTCCAGGGCTTCTTGGTCTGGAGCTTGTTCATGGCGTTCAGGTTCAGGGTCGCCTCCTCCTCAC
TCTGTCCACCGGAGAGGAAGACAATGGCAGGGACGGCAGCAGGGACGGTCCTCTGGAGGGTGCGGACGGTGTACTCAGCAATCACCTCAGGGGCTACCTT
CTTGGCGTCGGAACCAGGGGTAACCATGTTGGGCTTCAGGAGGGTACCCTCAAGGAGGACATGCTGGTCGTTGAGAGCCTTGTAGCAGGCAGCAAGGACC
ATCTCGGTCACATAAGCACAGCGGTCAATGTCATGAGGTCCATCAACAAGGATCTCAGGCTCAACAATGGGCACCAGCCCATTCTCCTGGCAG
page-top