Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11797  (registered. 2007)
Contig Information
Length 882 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0193000 [Oryza sativa (japonica cultivar-group)] >gi|51090793|dbj|BAD35271.1| putative ubiquitin conjugating enzyme [Oryza sativa Japonica Group] >gi|113595080|dbj|BAF18954.1| Os06g0193000 [Oryza sativa (japonica cultivar-group)] >gi|125554386|gb|EAY99991.1| hypothetical protein OsI_21994 [Oryza sativa Indica Group] >gi|125596336|gb|EAZ36116.1| hypothetical protein OsJ_019599 [Oryza sativa (japonica cultivar-group)] >gi|215694359|dbj|BAG89352.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1010
Evalue 8.91541e-108
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11797
tgtctccaggtggtagtccacggatgaagaatgagttgcacaaaccaacagaaagctatacaaaattacggcaccactgtcacaCTTTATTCGACTTTTT
ACtgtcaaagTTGCATCAGGGGCAAGGCCATCACCGCGCCAAAAACAGAGACGATAACCACCATCAGCCAAAAGGGCACTCGCTTCTTCAGCTTCTTTTC
GCCGCGGACCTCGGCCACTGGTCTTCCTATATTGTTCACCATTGCTGCCGCTTGCTGGACAGCGGCAGGAGAAGGAGCTGGGGCAGGGTTCTCCTGGGGC
TCTGGTTCCGCTCCAGTTTGCTCCTTTTCTAGTTGTTGGTTGTACTTCTCAACATACTCAGGAAACAGTTTCCTGAAGTGCGGGCAATTTTTGCTCTCAC
AGTTGTAAGCAAGAGAAGCCTTAGCTAAACGCTTCTTCTCTCCATCTGTACTTCTGATGCTTCCAGTTGTAAGAGCATCATCCATCATAAATGAGAGGAG
TCCTGTTAGAATGCTTGCTACAGACCACATGGGATTCCAAGATTCTGGATGAAAGTCACTCATTGATAGGCATATCCTTTTGTGAGGGGCAAACCTGCCG
CTGGGGGTTGTCATGCTGATACTTGGAGGTTTAAAAGGGTAATCAGAGGGAAATTTAAGCTTCCCATAGTAATATCCACCTTCAAAGGGTGTGGCTACAC
TTCCTTCAAGTACAAAATGCCACTCCAATATGTCGTT*GGGCAGCGGGCGCGCCACGATCTGCGGCACCGGct*cctTGCAGAGCGCGTGGTAct*cctt
ctGGAGGCGCTTGAGGCAGCCCTTGTCGGCCATGGCGtaaaccctAGGCGGCCGCgccggcctcgtgccgaattncctgcag
page-top