Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11754  (registered. 2007)
Contig Information
Length 1146 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10569 [Oryza sativa Indica Group] >gi|215769370|dbj|BAH01599.1| unnamed protein product [Oryza sativa Japonica Group]
Score 972
Evalue 3.45927e-103
Total Hit Count 143
Registered year 2007
Contig Sequence     [ Download ]
>Contig11754
ggcgtcttgtgccgctgagccgcagtgttggattccctctctctctctgcagcactgctccggacggagctcccttctcctggggttccggttcACTCAc
gggctCACAGTAacccacagttcacggaTTCATTTGCTTGTTCGATCTGTAGATCCTGCGAGCTCGGCTCGTCGCGAGTAACCGCCGCCATGTCGTCGTC
CGATCCGTCGCTGGCGACCGAGGCGCCCCAGGCGGCCGTCACCAGCGAGCGCAAGCTCAGCCCCGACCTGCAGGAGCAGCTCGCCAAGCCATATCTGGCC
AGAGCAATGGCGGCGGTTGACCCGAGCCACCCGGAGGGCAGCAAGGGTCGGGACACCAAGGGGATGAGCGTGCTCCAGCAGCACGCCGCCTTCTTCGACC
GCAACGGCGACGGGGTCATCTACCCATGGGAGACCTTCCAAAGCCTCCGAGCAATCGGGCTT*GGGTCGCCTTCGGCCTTCGGAACATCCATACTCCTCC
ACCTCGTCCTCACTTATCCTACTCAACCGGGATGGATGCCTTCCCCTCTGCTCTCGATCCATATAAAGAACATCCACAGGGGCAAGCACGGGAGCGACTC
TGAGACGTATGACACTGAAGGGAGGTTTGAACCAGCGAAATTCGATGCTATATTCAGCAAGTTTGGCAAAACTCGGCCGAATGCTTTGTCAGAAGATGAG
ATCAACGCCATGCTTAAACACAACCGCAATATGTATGATTTCCTGGGCTGGGCCGCAGCCAACCTCGAATGGAAGCTGCTGCACAAAGTGGCAAAGGATA
AAGAAGGCTTTTTACAGCGAGAAATCGTGAGGGGCGCCTTCGATGGCAGCCTGTTCGAGCGCCTGCAGGAGAGCAAGAAATCTACCTGAATGCGGCAGTG
AGCCGTGCGCAGTCCAGACCGAGCGTCGTCAATGAAACATCTGCACTTGAAATTTGAAAAGCCTCCCTGCATTGTAGTTTGAGTTCTGCACGTCAAATAA
GAAGTGTTTGGCCCGTCTACGGCGGCCTAAACATTTTCATTTGTATTGTTattttgaactggaatttgtactgttattggtagcgcacacaaggtgtaca
gtggaactttgtaatgtgcactcgtaaccatcagtacctcgcgtaa
page-top