Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11718  (registered. 2007)
Contig Information
Length 606 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0900800 [Oryza sativa (japonica cultivar-group)] >gi|56784863|dbj|BAD82103.1| putative helix-loop-helix protein 1A [Oryza sativa Japonica Group] >gi|113534637|dbj|BAF07020.1| Os01g0900800 [Oryza sativa (japonica cultivar-group)] >gi|215687014|dbj|BAG90828.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189543|gb|EEC71970.1| hypothetical protein OsI_04807 [Oryza sativa Indica Group] (no hit)
Score 153
Evalue 2.20697e-08
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>Contig11718
gaggcCTCTCTTGCCCTCACTTTCTCCGTCGATGGCTTGCCCGAACCTGACGATCGACGGGGCGGACGAGCTGGCGCACTTCGggcATCCCCGTCACGTC
GggaCGTGCGGTTGCCATCGCGGTGGCGACTGAGCGCGGCGGGGGTGCCTGTGCTGCCGCTGCCGGATGTCTGCTCGCACCTCTTCATGCGCGCCGTCAG
GCTCTACCGGGCGCGGCTGCCGGTGGATATGTCAGGCCCTGAACCTCGCGCATACTGAAGAACAAGCACCAGATCAAGTTCAGACAAGCAACGGCTAGGA
TGAAGCGATGACGTTTCGGAGAAATCAATGGCTCGGATGAATCCTCGCCTTTTACCAGTAGTTTTAAACTCTGTACTGCTTTGTAACCGTTTAACGACAG
TAACAGAAAGTTACAGCGAGGAGCTGGACTAGTATAAGAGAACCAGGTCGCGTGAGGGAGAGGCTAAGATGTAATTCCCCATTTCTAGTCAAGATAGAAC
CCTAGCTATGTACGGCAAGACGGGGTATCTCCCCTCTTGATCTACCTCTTGTATCCAAATTCCTCCatgaaatCCAACTtaatatcctgaatcctcaaaa
aaaaaa
page-top