Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11669  (registered. 2007)
Contig Information
Length 885 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HMG1/2-like protein [Zea mays] >gi|195640852|gb|ACG39894.1| HMG1/2-like protein [Zea mays]
Score 459
Evalue 7.04215e-44
Total Hit Count 346
Registered year 2007
Contig Sequence     [ Download ]
>Contig11669
ctcctcccccgCAGCAAGAGAGATCCAgccagaTCCGTCCAGTTCCATGGCCACCGCCGGCAACGCCCCCCGCTCCCGCAAGCGCGTCGAGGCCACCGTC
CTCAAGCGCGCGCGCGACGGGAGCGCCTTCACCCGCTGCGAGGCGTGCAACAAGGACGTAGCCATCGTCCTCATCGACCTGCACAGCTGCAGCCTCGACT
CCAAGATACGCCTCAGCCTCGAGTCGCAGGTGGTGGAGAAGGCCGTGGAGATCCAGGAGAAGAAGAGGAAGGCGCCCTCCGCTGCCGCCGGAGGCAAGGG
GAAGAAGAAGAGCAAGGCAGACGGAGATGGTGCCAAGAAGCTAAAGGCAAAGCGCCCACCAACTGCCTTCTTCCTCTTCATGAAGGACTTCAGGGTGGAG
TTCAAGGCCTCCCACCCCGATGAGAAGGGTGTTGCCGCCGTTGGCAAGGCAGCAGGGGAGAAGTGGAAATCCATGACTGAAGAGGAGAAGAAGCCCTACA
ATGACCAGGCCAAGGAGCTCAAGGCCCAGTTTGCCAATGGCGAGGGCAGCGCGGAGAACAATGTGGGAGATGAGGAGAAGGCAGATGCTGACGCAGAAGA
GGTGGAGGATGCGGAACAGGAGGTGGATAAGCCAGAAGATGCCCCAGAGGACGAGGAGGAGGAAGAGGAGAAGAACGAGCTGGATGATGACATCTAGACG
GGACTGAAGAAGGGTGCTAGTTTCTGTTTTGTAAATGGCAGGTGTTCTACCTATCTGTCCTGGGCAACCTGAATCTTGGCCTAAACTCTAGTAGCAGCAG
TAGTGAATGTTG*GGCTGGTTGCAGTCTGTTTATCATTGTtatggaatGGAAGGAAAGCAGGgttgatgtggtggttgatgaaaa
page-top