Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11646  (registered. 2007)
Contig Information
Length 724 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0372800 [Oryza sativa (japonica cultivar-group)] >gi|49387799|dbj|BAD26364.1| putative serine/threonine-protein kinase 16 [Oryza sativa Japonica Group] >gi|113631260|dbj|BAF24941.1| Os09g0372800 [Oryza sativa (japonica cultivar-group)] >gi|125563490|gb|EAZ08870.1| hypothetical protein OsI_31131 [Oryza sativa Indica Group] >gi|125605482|gb|EAZ44518.1| hypothetical protein OsJ_028001 [Oryza sativa (japonica cultivar-group)] >gi|215704493|dbj|BAG93927.1| unnamed protein product [Oryza sativa Japonica Group]
Score 950
Evalue 5.70726e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11646
tcgaatcgaaccaactaaacaagcacagctgacacccacccctccgccaccgcagtcgCCGGTGaccaggaCGCGCATCCGAGTTCGCCGGCGGCGAGGA
GAAGGGCGCCGAGTATGGGGTGCTCCCTCTCGGGGCTCAACGCCCTCTACGACGCAGCGACTGGCGGCGGCGACGTGTGGATCAACGAGCGCCGCTTCCG
CGTCCTCCGCCAGATCGGCGAGGGCGGCTTCGCCTTCGTCTACCTCGTCAAGGAGCACGAAGCCTCCTCCGGCGCTGCGCGCGACAGGCACCCCTCCCAC
GTCTCAGACGACGGGACATATGCTATGAAGAAGGTGCTGATACAGAGCAGGGAGCAGCTGGATCTGGTGAAGGAGGAGATCCGCGTTTCGTCCTTGTTCA
ACCACCCCAATTTGCTACCGCTTCTTGACCATGCCATAATAGCAGTTAAGAGTACACAGGGAGATTGGAGCCATGAAGCCTACTTACTCTTCCCAGTCCA
TTTGGATGGTACTCTGTTCGACAATGCTGCAGTCATGCAGTCAAGGAAAGAGTTTTATTCGGTGGTCGATGTTTTGCGAATATTCCAACAGATTTGTGAA
GGACTGAAGCACATGCATAGTCTTGATCCACCATATGCCCATAATGATGTCAAGCCTGGCAATGTTCTTGTAACCTGCCGAAAAGGGCAAGCACCTCTTG
CAACTTTGATGGATTTTGGAAgtt
page-top