Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11642  (registered. 2007)
Contig Information
Length 690 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_h Spike at heading date 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0847200 [Oryza sativa (japonica cultivar-group)] >gi|15408881|dbj|BAB64272.1| putative GMPase [Oryza sativa Japonica Group] >gi|20160631|dbj|BAB89577.1| putative GMPase [Oryza sativa Japonica Group] >gi|113534326|dbj|BAF06709.1| Os01g0847200 [Oryza sativa (japonica cultivar-group)] >gi|125602660|gb|EAZ41985.1| hypothetical protein OsJ_025468 [Oryza sativa (japonica cultivar-group)] >gi|215692841|dbj|BAG88187.1| unnamed protein product [Oryza sativa Japonica Group]
Score 810
Evalue 8.84361e-85
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11642
gccgaggcctTCATCTTGGCAGTCTGGTACCCGGGGTACCACTGGCATATTCTCTTCCCGGTCTTGGCGAGGGGGCAAGAAACAGGCGACCGACCGGCCA
AAACAAGCTCGCTCGGCGCTGCTTCCGAATCTGACCCCGTCGGCTCCTCCttcCTCATCCAGGGATCA*GAGGGGAGGAAGAAGGGGGACGCCTCGCCAT
GAAGGCGCTCATCCTCGTCGGGGGCTTCGGGACCCGCCTCCGGCCTCTCACGCTCAGCTTCCCCAAGCCCCTCGTCGATTTCGCCAACAAGCCCATGATT
CTGCACCAGATTGAAGCCTTGAAAGATGTCGGTGTTACAGAGGTTATTTTAGCCATCAACTACCGCCCAGAGGTCATGATTAATTTCTTGAAGGATTTTG
AGGATAAGCTTGGCATCACAATCACATGCTCCCAAGAGACTGAACCCTTGGGAACTGCTGGCCCTCTTGCCCTGGCAAGGGACAAGCTCGTGGATGGATC
TGGTGAGCCGTTCTTTGTCCTCAACAGTGATGTCATAAGTGAATACCCATTTGCCGAGCTCATACAGTTTCACAAGAGCCATGGCGGTGAGGCAACAATT
ATGGTCACTAAGGTGGATGAACCTTCGAAATATGGAGTTGTGGTTATGGAGGACACAACtggagttgtggaaagatttgtagagaagcca
page-top