Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11624  (registered. 2007)
Contig Information
Length 571 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021929 [Oryza sativa (japonica cultivar-group)]
Score 251
Evalue 3.70834e-20
Total Hit Count 362
Registered year 2007
Contig Sequence     [ Download ]
>Contig11624
gcaccaccggagccggagGAAGAGAGGAAGGGAGAAGCCAACAGGTAACGATGGTGTCCGGCTCCGGTGTGTCCGCGCGTCGCGTGGTGGTGGATGCGCG
CCACCACATGCTGGGTCGCCTTGCGTCGATCGTGGCCAAGGAGCTGCTCAACGGGCAGCGCGTGGTGGTGGTCCGGTGCGAGGAGATGTGCATCTCCGGC
GGGCTGGTCCGTCAGAAGATGAAGTACCTCCGCTTCCTCCGCAAGCGGATGGAACTACCATGAAACTATCAAGGAACTGGAGGAGAAGAGAAAGGAGAAG
GCTAAGGTGTCGTACGACAGGAGGAAGCAACTGGCCAAGCTGCGCGTCAAGGCTGAGAAGGCTGCCGAGGAGAAGCTGGGTTCTCAGTTGGACATCCTGG
CACCAATCAAATACTAGTGTGCCCCGCAGTCATGCATCGTCTGTTTTGCTGGATAATGGTGGTTATTGTTTACGTTATTAGTAGCCTGAGAGTGTCGTTG
AGATTTGAAACCTCTGAATATCTATACTCTTCCAATCTTTGTAGCAAATGGATTGTTTGGtaaaaaaaaaa
page-top