Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11622  (registered. 2007)
Contig Information
Length 556 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0498200 [Oryza sativa (japonica cultivar-group)] >gi|9967162|dbj|BAB12275.1| cytochrome c oxidase subunit 6b [Oryza sativa Japonica Group] >gi|9967279|dbj|BAB12339.1| cytochrome c oxidase subunit 6b [Oryza sativa Japonica Group] >gi|38345393|emb|CAD41243.2| OSJNBa0067K08.22 [Oryza sativa (japonica cultivar-group)] >gi|90265127|emb|CAC09495.2| H0711G06.1 [Oryza sativa (indica cultivar-group)] >gi|113564783|dbj|BAF15126.1| Os04g0498200 [Oryza sativa (japonica cultivar-group)] >gi|116310722|emb|CAH67519.1| OSIGBa0092E01.14 [Oryza sativa (indica cultivar-group)] >gi|215766962|dbj|BAG99190.1| unnamed protein product [Oryza sativa Japonica Group]
Score 405
Evalue 4.73524e-38
Total Hit Count 226
Registered year 2007
Contig Sequence     [ Download ]
>Contig11622
gcCCGTCTGTCCGCTCCGCGACGCCGCGATTCCATCCTCGCCTCCGATCTCCAG*CTTCCTCCCAGCCGACGAG*ATGGCCGAGATTGAGATTAAAACAG
CACCTGCTGACTTCCGCTTTCCTACAACCAACCAAACTAGGCATTGTTTTACTCGCTATGTTGAGTTCCACAGGTGTGTGAGTGCCAAGGGGGATGAAGC
TGCTGAATGTGAGAAATTTGCCAAGTACTACCGATCTCTTTGCCCAGCTGAATGGGTTGAGAAGTGGAACGAGCAGAGGGAGAACGGGACATTTGCAGGG
CCCCTCTAAATCATCTGTTTGAGAGTCTCCTCAATTGCTTTCGCGTCAGCGCTACTACTGTCTTCTGGCTTGGAATTTATGCTCCTGCCATGTAGTACTA
TTCTTCCAGCAAATCGCTGCAGAACAGCAAGTGATGCTTTTCTCTATGTTGCACTAATAATTCAGCATGCTTATATATTCTGTCATTGAGACATGCCTTT
TCACATTTATTAAATGGATTATATTctgaaatgaggtttcattgccaaaaaaaaaa
page-top