Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11606  (registered. 2007)
Contig Information
Length 523 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os03g60950 [Oryza sativa (japonica cultivar-group)] >gi|125588456|gb|EAZ29120.1| hypothetical protein OsJ_012603 [Oryza sativa (japonica cultivar-group)]
Score 166
Evalue 2.1246e-10
Total Hit Count 8
Registered year 2007
Contig Sequence     [ Download ]
>Contig11606
gCTGCGCTCCAACATCCCGGCGGCGAGGAAGAGAAGGCGGCGGAGATGGCGGTGATGGACACGGCGTTCAAGGTGCTGACGGCGGGGCTGGGCGTCGCGA
CGCTCTACCTGGCCGGCTCCTTCTCCTTCAACGTCTACCGCGGCCTCGCCTGGCACTCCGAGCAATCCAAGCTAGAAAAAGAAAAGGAGAAGAATGAAGA
TTGAGAAGGAAGGACGGCAAGTTAGTGTCGGGGATTATTACCAACCAAAAGGACCTACAAAAAATCTCGACTTGTGGTTATGTTTTCTGGGACTGATTTC
CAGGCGGTTCCTTTGATGTAATATAGATTCAGGATTTGGATGATCATATCTCTTTAAGTGCTCTCAGTTTTTACATATTTCTGCGTTGCACTAAATAagg
gtgcTCTGAGATGGAAGACAAGATATGTGTGTTCTGTGAATCTTTTCCTTCGGGCATTATTACACACTTAGGATCAGTTGAATGAAACATATGAAAACTG
CTcatgtgtttccaaaaaaaaaa
page-top