Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11586  (registered. 2007)
Contig Information
Length 930 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ubiquitin-activating enzyme E1 2 >gi|170684|gb|AAA34265.1| ubiquitin activating enyme
Score 576
Evalue 2.08784e-57
Total Hit Count 248
Registered year 2007
Contig Sequence     [ Download ]
>Contig11586
cccgggctgaggaattcggacgAGGCgccnatCCCCCCTCTCTCCGATCCTCCTCCCCCTCGCTCTCCCCGCCTCACGACGAGCCGCCCGCGgccngtTG
CAGGCCCCTCCTCGCACGCTGGATCTGTCGCGGCAGCTCCCGCCGGCCGCCTACTACTACTGCCTGCTTTTCGCGGCGGCGGCTGGGCTCATCGGCGGCG
TCGCGCACTATATGCTTCCTCGGAAGCGGGAGGTCGTCGCCAGCGAGGTCGATAACTTGCAGAAGAAAACCCGCCCCGCTGCCGCCGACGACGCCATGGC
CAGGCCCACGGAGATCGACGAGGACCTCCACTACCGCAACACGTTTGCAAACCTGGCAATCCCCCTCTTCTCCATTGCCGAGCCGGTCCCACCCAAGACC
ATCAAGCACAAGGACTTGTCCTGGACGGTCTGGGACCGGTGGACCGTAACAGGCAACATCACGTTACGGGAGCTCCTGGAGTGGCTCAAGGAGAAGGGGT
TGAACGCATACAGCATATCGTGCGGCACGTCGCTCCTGTACAACTCCATGTTCCCCAGGCACAAGGAGCGGTTGGACAGGAAGGTGGTCGACGTTGCCAG
GGAGGTGGCCAAGATGGAGGTGCCATCGTATCGGCGCCATCTGGATGTTGTGGTGGCCTGCGAGGATGATGATGACAATGACGTTGACATCCCACTCGTA
TCTGTCTACTTCCGTTGAAAGGATTCCCTCTGAATTGACATCATCTCGTGTCCCATCTTTCCAGTGAGTTACTTTATATAGTTATACTGTAAACTGAGCT
GGGGTTTAAAGCAATATTACTGATTTTCGTATGCACCGACTTGTTAGAGCTCAGTTCAGATCCTTtggaaaatgtggtGTCGAGcttgatACCTCACcgt
gataattgatgcatggcaccgttgaacttg
page-top