Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11543  (registered. 2007)
Contig Information
Length 1106 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0535000 [Oryza sativa (japonica cultivar-group)] >gi|50251871|dbj|BAD27799.1| chaperone protein dnaJ-related-like [Oryza sativa Japonica Group] >gi|50253051|dbj|BAD29300.1| chaperone protein dnaJ-related-like [Oryza sativa Japonica Group] >gi|113536569|dbj|BAF08952.1| Os02g0535000 [Oryza sativa (japonica cultivar-group)] >gi|218190910|gb|EEC73337.1| hypothetical protein OsI_07539 [Oryza sativa Indica Group]
Score 999
Evalue 2.42429e-106
Total Hit Count 409
Registered year 2007
Contig Sequence     [ Download ]
>Contig11543
cgtgtcgcggcaccggcctgtcttgcctagccgcggcctcggcgacgccgccagcgtcaaggcctacggcccagcgtctgtttgttgcggtggccgctcc
tccccgttggcggtccgttgagcctcatcccgctgtatggaggagtgaaggcccccgggctctaacgatgctacggaggtgctctcccgccggcgactcc
agggcgcccggagacggcagcctttccagtttttgcattattgaaggcccagagacaatacaagacttcgttcagatgcaatcacaagagattcaagaca
acatcaagagtcggcgcagcaaaatattcgttttgatggaagaggtcAGACGACTGCGGGTGCAGCAGCGAATCAGAGCTGCTGAAAGCAGATGTTCCAG
CAGTGAAGAAAATGAGATGCCGGAGATGCCATCTACCATTCCGTTTTTGCCTTATACGTCACCAAAGACAATGAAGCAACTCTACTTGACATCATTCTCT
TTCATATCTGGGATAATCATTTTTGGTGGCTTAATAGCCCCAATACTTGAACTGAAATTAGGGCTTGGTGGTACCTCTTATGAAGATTTTATACGGAACA
TGTATTTACCTCTTCAGTTAAGTCAGGTAGATCCCATAGTGGCGTCCTTTTCAGGTGGTGCAGTTGGTGTAATTTCAGCCTTA*ATGTTGGTTGAAGTGA
AAAATGTGAGGCAGCAAGAAAAGAACAGATGCACATATTGCCATGGGACAGGATACCTGCCATGTGCCCGTTGCTCTGCCAGCAAAATGTTGTTGGGCAC
CAAACGCTTTTCACTTTCTACAACTGAACGCTGTTCCAATTGTTCAGGAGCTGGGAAGGTGATGTGCCCAACATGCTTGTGCACGGGAATGGCAATGGCA
AGTGAGCATGACCCACGTATAGATCCCTTTGACTAATGTTGGGCAATTTGACGTGTGCCTGCTTA**ATGCTATTTCCTTTTTCTATCTAGCTGTTGTTT
TCTATGGCTGTGGTAGGGCTTGAATCAGTCTTCGATGTATGCTACGAGTTATAGCGAG*ATGAAGTTcgcagtaatgatgatcagatcaaatactgnaaa
aaaaaa
page-top